Transcript: Human NM_014978.3

Homo sapiens sortilin related VPS10 domain containing receptor 3 (SORCS3), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SORCS3 (22986)
Length:
5575
CDS:
39..3707

Additional Resources:

NCBI RefSeq record:
NM_014978.3
NBCI Gene record:
SORCS3 (22986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_014978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063232 GCAGGTATCAAAGGGATATTT pLKO.1 1524 CDS 100% 15.000 21.000 N SORCS3 n/a
2 TRCN0000426432 ACAGACGAGAACCAAGTATTT pLKO_005 1359 CDS 100% 13.200 18.480 N SORCS3 n/a
3 TRCN0000063228 GCCAGCTACTACGTGTCTTAT pLKO.1 1269 CDS 100% 13.200 18.480 N SORCS3 n/a
4 TRCN0000174509 CCAGGATGAATATATCTTCAT pLKO.1 1226 CDS 100% 0.495 0.693 N Sorcs3 n/a
5 TRCN0000063229 CGTCATACTTATCCTGACGAA pLKO.1 665 CDS 100% 0.264 0.370 N SORCS3 n/a
6 TRCN0000414736 ACTATGGAGGTCGACAGATTA pLKO_005 725 CDS 100% 13.200 9.240 N SORCS3 n/a
7 TRCN0000415397 AGCTCTCATATACTGATATTG pLKO_005 1786 CDS 100% 13.200 9.240 N SORCS3 n/a
8 TRCN0000426648 CTCTGCCATTGGTAGCTTAAA pLKO_005 3959 3UTR 100% 13.200 9.240 N SORCS3 n/a
9 TRCN0000063230 GCACAATGCAACTTTCATCAT pLKO.1 2552 CDS 100% 4.950 3.465 N SORCS3 n/a
10 TRCN0000063231 CCGAGTTCCATTTGTTGCCAT pLKO.1 2795 CDS 100% 2.640 1.848 N SORCS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_014978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488612 GTGGATCTCCCCGGTCACGTTGGC pLX_317 8.2% 99.9% 100% V5 1368C>T n/a
2 TRCN0000491737 TACACAACTTACAGCATTCAAGTC pLX_317 7.2% 99.9% 100% V5 (not translated due to prior stop codon) 1368C>T n/a
Download CSV