Transcript: Human NM_015012.4

Homo sapiens transmembrane protein 41B (TMEM41B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TMEM41B (440026)
Length:
3798
CDS:
153..1028

Additional Resources:

NCBI RefSeq record:
NM_015012.4
NBCI Gene record:
TMEM41B (440026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158852 GTTGAACGTCATAGAGAACAT pLKO.1 720 CDS 100% 4.950 6.930 N TMEM41B n/a
2 TRCN0000344438 GTTGAACGTCATAGAGAACAT pLKO_005 720 CDS 100% 4.950 6.930 N TMEM41B n/a
3 TRCN0000159112 GTTTCCTGGAACTCAATATTT pLKO.1 933 CDS 100% 15.000 10.500 N TMEM41B n/a
4 TRCN0000344439 GTTTCCTGGAACTCAATATTT pLKO_005 933 CDS 100% 15.000 10.500 N TMEM41B n/a
5 TRCN0000160208 CCTAACAGAGAAAGCAGTAAA pLKO.1 686 CDS 100% 13.200 9.240 N TMEM41B n/a
6 TRCN0000344437 CCTAACAGAGAAAGCAGTAAA pLKO_005 686 CDS 100% 13.200 9.240 N TMEM41B n/a
7 TRCN0000159035 GAACAACACTGTATCAACTTA pLKO.1 895 CDS 100% 5.625 3.938 N TMEM41B n/a
8 TRCN0000160983 GCAGGAACAACACTGTATCAA pLKO.1 891 CDS 100% 5.625 3.938 N TMEM41B n/a
9 TRCN0000158584 CCTCTTTCTGTTATATGCTTT pLKO.1 631 CDS 100% 4.950 3.465 N TMEM41B n/a
10 TRCN0000160235 CGTCATAGAGAACATCTCATT pLKO.1 726 CDS 100% 4.950 3.465 N TMEM41B n/a
11 TRCN0000159250 GCCCATGTAAATTCAAGCTTT pLKO.1 3567 3UTR 100% 4.950 3.465 N TMEM41B n/a
12 TRCN0000344440 GCCCATGTAAATTCAAGCTTT pLKO_005 3567 3UTR 100% 4.950 3.465 N TMEM41B n/a
13 TRCN0000158853 GAATAACACCATTTCTGCCTA pLKO.1 766 CDS 100% 2.640 1.848 N TMEM41B n/a
14 TRCN0000165600 GACTGTCAAGAAAGGACCCTT pLKO.1 3481 3UTR 100% 2.640 1.848 N TMEM41B n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1758 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1758 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015012.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13686 pDONR223 100% 64.6% 43.9% None 368_369insTTACCAG;570_873del n/a
2 ccsbBroad304_13686 pLX_304 0% 64.6% 43.9% V5 368_369insTTACCAG;570_873del n/a
3 TRCN0000476364 GATATCAAAAAACTAAAAACATCT pLX_317 60.1% 64.6% 43.9% V5 368_369insTTACCAG;570_873del n/a
Download CSV