Transcript: Human NM_015130.3

Homo sapiens TBC1 domain family member 9 (TBC1D9), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TBC1D9 (23158)
Length:
5554
CDS:
341..4141

Additional Resources:

NCBI RefSeq record:
NM_015130.3
NBCI Gene record:
TBC1D9 (23158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015130.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055710 CCTACGAGAAATTCGGAACTA pLKO.1 2670 CDS 100% 4.950 6.930 N TBC1D9 n/a
2 TRCN0000055711 CGCTCCTTACCGAATCTTGTA pLKO.1 520 CDS 100% 4.950 6.930 N TBC1D9 n/a
3 TRCN0000055709 CCTGGGTACTATGAAGACCTA pLKO.1 1955 CDS 100% 2.640 3.696 N TBC1D9 n/a
4 TRCN0000055708 GCAAAGGATTTACCCAAATTA pLKO.1 3392 CDS 100% 15.000 10.500 N TBC1D9 n/a
5 TRCN0000370766 TCCCGCTTGTTCCAGTTATTA pLKO_005 3014 CDS 100% 15.000 10.500 N TBC1D9 n/a
6 TRCN0000376656 CTTGGTTCCTCACACTATTTC pLKO_005 2367 CDS 100% 13.200 9.240 N TBC1D9 n/a
7 TRCN0000365556 GCATAGTCAGCGAGGGTAAAT pLKO_005 4594 3UTR 100% 13.200 9.240 N TBC1D9 n/a
8 TRCN0000376655 TGCAAGACCTGGGCGTGATTT pLKO_005 2331 CDS 100% 13.200 9.240 N TBC1D9 n/a
9 TRCN0000055712 CCTGCAACAGACTACTTCCAA pLKO.1 1534 CDS 100% 3.000 2.100 N TBC1D9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015130.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07845 pDONR223 99.8% 99.9% 100% None 3153C>T n/a
2 ccsbBroad304_07845 pLX_304 0% 99.9% 100% V5 3153C>T n/a
3 TRCN0000479305 GCAAACTTTAATGTTCCAACAGAT pLX_317 11.5% 99.9% 100% V5 3153C>T n/a
Download CSV