Transcript: Human NM_015192.4

Homo sapiens phospholipase C beta 1 (PLCB1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PLCB1 (23236)
Length:
7088
CDS:
387..4037

Additional Resources:

NCBI RefSeq record:
NM_015192.4
NBCI Gene record:
PLCB1 (23236)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015192.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226441 CAGCGAGATCCTCGGCTTAAT pLKO_005 1143 CDS 100% 13.200 18.480 N PLCB1 n/a
2 TRCN0000226443 TTCGGCCAGGCTATCACTATA pLKO_005 2686 CDS 100% 13.200 18.480 N PLCB1 n/a
3 TRCN0000011061 CCCATTTGAATCTCGTGGCTT pLKO.1 730 CDS 100% 2.640 3.696 N PLCB1 n/a
4 TRCN0000226442 TCTAATCTGGTGAACTATATT pLKO_005 2007 CDS 100% 15.000 10.500 N PLCB1 n/a
5 TRCN0000218583 AGTGTCAGAACAATCAGTTAA pLKO_005 3529 CDS 100% 13.200 9.240 N PLCB1 n/a
6 TRCN0000426090 AGTGTCAGAACAATCAGTTAA pLKO_005 3529 CDS 100% 13.200 9.240 N Plcb1 n/a
7 TRCN0000219109 ATTGGCCTGAAATGATCAAAT pLKO_005 4822 3UTR 100% 13.200 9.240 N PLCB1 n/a
8 TRCN0000007002 CCAGTCAAGTTTGAGTCATTT pLKO.1 2031 CDS 100% 13.200 9.240 N PLCB1 n/a
9 TRCN0000007004 CCAGTGGAATTTGTAGAATAT pLKO.1 2133 CDS 100% 13.200 9.240 N PLCB1 n/a
10 TRCN0000007001 CCGAAGTAGATTTAGAACTTA pLKO.1 5266 3UTR 100% 5.625 3.938 N PLCB1 n/a
11 TRCN0000076911 GCTGTCTTTGTCTACATAGAA pLKO.1 2748 CDS 100% 5.625 3.938 N Plcb1 n/a
12 TRCN0000007003 GCTCAAAGAAATCTGTGAGAA pLKO.1 3554 CDS 100% 4.950 3.465 N PLCB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015192.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07859 pDONR223 100% 99.9% 100% None 2988T>C n/a
2 ccsbBroad304_07859 pLX_304 0% 99.9% 100% V5 2988T>C n/a
3 TRCN0000471930 CGACTGTTATCACCCAATCAACCT pLX_317 12.8% 99.9% 100% V5 2988T>C n/a
4 ccsbBroadEn_15752 pDONR223 0% 95.3% 94.4% None (many diffs) n/a
5 ccsbBroad304_15752 pLX_304 0% 95.3% 94.4% V5 (many diffs) n/a
Download CSV