Transcript: Human NM_015269.2

Homo sapiens terminal uridylyl transferase 4 (TUT4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
TUT4 (23318)
Length:
5856
CDS:
254..5188

Additional Resources:

NCBI RefSeq record:
NM_015269.2
NBCI Gene record:
TUT4 (23318)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241804 ACACGTTTAGATAGCTTATTT pLKO_005 5345 3UTR 100% 15.000 21.000 N Tut4 n/a
2 TRCN0000423930 ACACGTTTAGATAGCTTATTT pLKO_005 5345 3UTR 100% 15.000 21.000 N TUT4 n/a
3 TRCN0000442267 AGTCGCCTGACCCAGATAAAT pLKO_005 2772 CDS 100% 15.000 21.000 N TUT4 n/a
4 TRCN0000147903 GCAACAGACATGTACAGATAA pLKO.1 895 CDS 100% 13.200 18.480 N TUT4 n/a
5 TRCN0000146303 CGTGATAGTGATCTGGATATT pLKO.1 3269 CDS 100% 13.200 9.240 N TUT4 n/a
6 TRCN0000435890 ATTAGCTGTATTCATACTTTG pLKO_005 5560 3UTR 100% 10.800 7.560 N TUT4 n/a
7 TRCN0000147949 GCTACTTATGCAGCTATTGAT pLKO.1 3509 CDS 100% 5.625 3.938 N TUT4 n/a
8 TRCN0000147608 GCTTCTGACCTTAATGATGAT pLKO.1 2897 CDS 100% 4.950 3.465 N TUT4 n/a
9 TRCN0000150277 GTCAGTTACATTCAGCAGAAA pLKO.1 5272 3UTR 100% 4.950 3.465 N TUT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015269.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07867 pDONR223 100% 99.9% 99.9% None 315G>A;3936_3937insAGC n/a
2 ccsbBroad304_07867 pLX_304 0% 99.9% 99.9% V5 315G>A;3936_3937insAGC n/a
3 TRCN0000469078 ATAGACGTCGAATAATTACGACAT pLX_317 6.3% 99.9% 99.9% V5 315G>A;3936_3937insAGC n/a
4 ccsbBroadEn_15756 pDONR223 0% 18.4% 17.9% None (many diffs) n/a
5 ccsbBroad304_15756 pLX_304 0% 18.4% 17.9% V5 (many diffs) n/a
6 TRCN0000475057 TGTTTCACAGGGTCCGTAATAGCT pLX_317 39.2% 18.4% 17.9% V5 (many diffs) n/a
Download CSV