Transcript: Human NM_015274.3

Homo sapiens mannosidase alpha class 2B member 2 (MAN2B2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
MAN2B2 (23324)
Length:
5129
CDS:
23..3052

Additional Resources:

NCBI RefSeq record:
NM_015274.3
NBCI Gene record:
MAN2B2 (23324)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015274.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000372959 TGGCGAGCACCCTTCAATTTG pLKO_005 1698 CDS 100% 13.200 18.480 N MAN2B2 n/a
2 TRCN0000372900 TGGCAGGAAATGGTCATATTT pLKO_005 3179 3UTR 100% 15.000 10.500 N MAN2B2 n/a
3 TRCN0000049633 CCTGAGTGAATCCTACAAATA pLKO.1 3916 3UTR 100% 13.200 9.240 N MAN2B2 n/a
4 TRCN0000372899 CTGCGTATGACCTGCTTATTC pLKO_005 1587 CDS 100% 13.200 9.240 N MAN2B2 n/a
5 TRCN0000049635 CCAGCCAACATCAACCTCTAT pLKO.1 788 CDS 100% 4.950 3.465 N MAN2B2 n/a
6 TRCN0000049634 CGGACGTTCTTTATTCACTTT pLKO.1 3020 CDS 100% 4.950 3.465 N MAN2B2 n/a
7 TRCN0000049636 GCCCTACGTTTCCTATGTGAA pLKO.1 2245 CDS 100% 4.950 3.465 N MAN2B2 n/a
8 TRCN0000049637 GCAGGAAATCTTCACGCACAT pLKO.1 631 CDS 100% 4.050 2.835 N MAN2B2 n/a
9 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 4457 3UTR 100% 10.800 5.400 Y LOC388949 n/a
10 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4297 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015274.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07868 pDONR223 100% 99.7% None (many diffs) n/a
2 ccsbBroad304_07868 pLX_304 0% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000475805 ATCTCTAAAAAGATGCATGTATGA pLX_317 10.1% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV