Transcript: Human NM_015365.3

Homo sapiens AMMECR nuclear protein 1 (AMMECR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-24
Taxon:
Homo sapiens (human)
Gene:
AMMECR1 (9949)
Length:
5350
CDS:
15..1016

Additional Resources:

NCBI RefSeq record:
NM_015365.3
NBCI Gene record:
AMMECR1 (9949)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419150 GGTGTACATGGCATTAGAATA pLKO_005 717 CDS 100% 13.200 18.480 N AMMECR1 n/a
2 TRCN0000119064 CCTTCCGCCATACAACCATTA pLKO.1 989 CDS 100% 10.800 15.120 N AMMECR1 n/a
3 TRCN0000119062 GAGGATACAAAGCTCCGATTA pLKO.1 847 CDS 100% 10.800 15.120 N AMMECR1 n/a
4 TRCN0000417843 GCTTCGACATCGTCAACTAAG pLKO_005 1145 3UTR 100% 10.800 15.120 N AMMECR1 n/a
5 TRCN0000119066 AGGAGGATACAAAGCTCCGAT pLKO.1 845 CDS 100% 2.640 3.696 N AMMECR1 n/a
6 TRCN0000119065 GTGCCCTTAAAGATAGCCGTT pLKO.1 598 CDS 100% 2.160 3.024 N AMMECR1 n/a
7 TRCN0000416238 GACCATATACAGACCATAGAC pLKO_005 810 CDS 100% 4.950 3.960 N AMMECR1 n/a
8 TRCN0000247205 CACTTACCAGTGCCCTTAAAG pLKO_005 589 CDS 100% 13.200 9.240 N Ammecr1 n/a
9 TRCN0000247208 TCCGCCATACAACCATTATTC pLKO_005 992 CDS 100% 13.200 9.240 N Ammecr1 n/a
10 TRCN0000119063 CTGCTCACTAACTTTGAAGAT pLKO.1 669 CDS 100% 4.950 3.465 N AMMECR1 n/a
11 TRCN0000247206 AGCAAGGATGGGACCATATTC pLKO_005 799 CDS 100% 13.200 9.240 N Ammecr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015365.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02273 pDONR223 100% 88.8% 88.8% None 474_584del n/a
2 ccsbBroad304_02273 pLX_304 0% 88.8% 88.8% V5 474_584del n/a
3 TRCN0000467763 TTCATAATAGTCATATGCATTCGG pLX_317 51.7% 88.8% 88.8% V5 474_584del n/a
Download CSV