Transcript: Human NM_015474.3

Homo sapiens SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 (SAMHD1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SAMHD1 (25939)
Length:
3189
CDS:
201..2081

Additional Resources:

NCBI RefSeq record:
NM_015474.3
NBCI Gene record:
SAMHD1 (25939)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144540 CAGAGCAATCAGGATTACTAA pLKO.1 1781 CDS 100% 5.625 3.938 N SAMHD1 n/a
2 TRCN0000141398 CCAGTGCTAAACCCAAAGTAT pLKO.1 1642 CDS 100% 5.625 3.938 N SAMHD1 n/a
3 TRCN0000140476 GCCAGTGCTAAACCCAAAGTA pLKO.1 1641 CDS 100% 5.625 3.938 N SAMHD1 n/a
4 TRCN0000343809 GCCAGTGCTAAACCCAAAGTA pLKO_005 1641 CDS 100% 5.625 3.938 N SAMHD1 n/a
5 TRCN0000145408 GCAGATGACTACATAGAGATT pLKO.1 1377 CDS 100% 4.950 3.465 N SAMHD1 n/a
6 TRCN0000352958 GCAGATGACTACATAGAGATT pLKO_005 1377 CDS 100% 4.950 3.465 N SAMHD1 n/a
7 TRCN0000142564 GCCATCATCTTGGAATCCAAA pLKO.1 1159 CDS 100% 4.950 3.465 N SAMHD1 n/a
8 TRCN0000343808 GCCATCATCTTGGAATCCAAA pLKO_005 1159 CDS 100% 4.950 3.465 N SAMHD1 n/a
9 TRCN0000145200 GCTTAGTTATATCCAGCGATT pLKO.1 500 CDS 100% 4.050 2.835 N SAMHD1 n/a
10 TRCN0000144409 CCCTGAAGAAGATATTTGCTT pLKO.1 980 CDS 100% 3.000 2.100 N SAMHD1 n/a
11 TRCN0000343807 CCCTGAAGAAGATATTTGCTT pLKO_005 980 CDS 100% 3.000 2.100 N SAMHD1 n/a
12 TRCN0000141013 CCACGTTGATACAATGAAGGT pLKO.1 530 CDS 100% 2.640 1.848 N SAMHD1 n/a
13 TRCN0000145220 GCACAATTCATTTAGAGGCTT pLKO.1 2118 3UTR 100% 2.640 1.848 N SAMHD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015474.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07967 pDONR223 100% 99.7% 99.6% None (many diffs) n/a
2 ccsbBroad304_07967 pLX_304 0% 99.7% 99.6% V5 (many diffs) n/a
3 TRCN0000468939 CGAAAACCCGTTACCAGGAAGCGT pLX_317 25.2% 99.7% 99.6% V5 (many diffs) n/a
Download CSV