Transcript: Human NM_015532.5

Homo sapiens RNA polymerase II subunit M (POLR2M), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
POLR2M (81488)
Length:
4114
CDS:
130..1236

Additional Resources:

NCBI RefSeq record:
NM_015532.5
NBCI Gene record:
POLR2M (81488)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015532.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426036 AGCTTTGACAACCTGTTTATT pLKO_005 688 CDS 100% 15.000 7.500 Y POLR2M n/a
2 TRCN0000418732 AGTTGATGTGGGTACAGATAA pLKO_005 402 CDS 100% 13.200 6.600 Y POLR2M n/a
3 TRCN0000061528 CCCTGTTAGTTTAGACTGTAA pLKO.1 357 CDS 100% 4.950 2.475 Y POLR2M n/a
4 TRCN0000061532 CCTACTCTTGAAGGTGATGAA pLKO.1 532 CDS 100% 4.950 2.475 Y POLR2M n/a
5 TRCN0000061529 GCACTTCAGAAACAGCAGAAA pLKO.1 1060 CDS 100% 4.950 2.475 Y POLR2M n/a
6 TRCN0000061531 CCTCATTACATGGAAGTGCTA pLKO.1 814 CDS 100% 2.640 1.320 Y POLR2M n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015532.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04232 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04232 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470258 GACTCACTTTCCCAACCTTTCTCA pLX_317 41.1% 100% 100% V5 n/a
4 TRCN0000489267 TTCGTCAAGATTATATCTACCTTT pLX_317 31.3% 99.9% 100% V5 (not translated due to prior stop codon) 183C>T n/a
Download CSV