Transcript: Human NM_015571.4

Homo sapiens SUMO specific peptidase 6 (SENP6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-14
Taxon:
Homo sapiens (human)
Gene:
SENP6 (26054)
Length:
6671
CDS:
646..3984

Additional Resources:

NCBI RefSeq record:
NM_015571.4
NBCI Gene record:
SENP6 (26054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015571.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010850 TCGATCTGAAATTGTTGCTAA pLKO.1 861 CDS 100% 4.950 6.930 N SENP6 n/a
2 TRCN0000004104 CACAGGATTAACAACCAAGAA pLKO.1 1446 CDS 100% 4.950 3.960 N SENP6 n/a
3 TRCN0000272838 CACAGGATTAACAACCAAGAA pLKO_005 1446 CDS 100% 4.950 3.960 N SENP6 n/a
4 TRCN0000272788 CCTTGATCCTCCGGCAAATAT pLKO_005 2307 CDS 100% 15.000 10.500 N SENP6 n/a
5 TRCN0000272790 CTCAGTGGGTGTGACATATTT pLKO_005 4338 3UTR 100% 15.000 10.500 N SENP6 n/a
6 TRCN0000272839 TGAGTCTACTGGACCATTATT pLKO_005 1380 CDS 100% 15.000 10.500 N SENP6 n/a
7 TRCN0000004102 CCGTGTTACCTTTCTCTATTA pLKO.1 4734 3UTR 100% 13.200 9.240 N SENP6 n/a
8 TRCN0000004105 CTACAGGAAGATCAGAGCAAA pLKO.1 3877 CDS 100% 4.950 3.465 N SENP6 n/a
9 TRCN0000272789 CTACAGGAAGATCAGAGCAAA pLKO_005 3877 CDS 100% 4.950 3.465 N SENP6 n/a
10 TRCN0000004103 GACAGAACTAACAGAAGAGAA pLKO.1 1672 CDS 100% 4.950 3.465 N SENP6 n/a
11 TRCN0000293608 GACAGAACTAACAGAAGAGAA pLKO_005 1672 CDS 100% 4.950 3.465 N SENP6 n/a
12 TRCN0000031019 CCCTTAATGAAGCTGCACATT pLKO.1 2921 CDS 100% 4.950 3.465 N Senp6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015571.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07981 pDONR223 100% 99.3% 99.3% None 455_475del;627A>G n/a
2 ccsbBroad304_07981 pLX_304 0% 99.3% 99.3% V5 455_475del;627A>G n/a
3 TRCN0000481041 CCACACCTATCACGACGTGAGGGG pLX_317 11.9% 99.3% 99.3% V5 455_475del;627A>G n/a
Download CSV