Transcript: Human NM_015879.3

Homo sapiens ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 (ST8SIA3), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ST8SIA3 (51046)
Length:
10087
CDS:
291..1433

Additional Resources:

NCBI RefSeq record:
NM_015879.3
NBCI Gene record:
ST8SIA3 (51046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036082 GCTGAGCACAGGTATTCTTAT pLKO.1 1184 CDS 100% 13.200 18.480 N ST8SIA3 n/a
2 TRCN0000415351 TCTTCAGCATGTCGATGTAAT pLKO_005 602 CDS 100% 13.200 18.480 N ST8SIA3 n/a
3 TRCN0000420165 TAAGGATTGTCTGCCATTTAA pLKO_005 1526 3UTR 100% 15.000 10.500 N ST8SIA3 n/a
4 TRCN0000438391 CCAAACGGAAAGCGCCAAATG pLKO_005 1439 3UTR 100% 10.800 7.560 N ST8SIA3 n/a
5 TRCN0000036081 CTATGATTATTCCAGCCATAA pLKO.1 674 CDS 100% 10.800 7.560 N ST8SIA3 n/a
6 TRCN0000036080 CCATACCATTACTATGACAAA pLKO.1 1293 CDS 100% 4.950 3.465 N ST8SIA3 n/a
7 TRCN0000036079 CCGGGAAATATAATGCAACAT pLKO.1 1122 CDS 100% 4.950 3.465 N ST8SIA3 n/a
8 TRCN0000036083 GTCACAATTTGCGCTGAAGTT pLKO.1 470 CDS 100% 4.950 3.465 N ST8SIA3 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 177 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015879.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03184 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03184 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477880 CGATATCTGTCACGTCTTCTCTTC pLX_317 31.1% 100% 100% V5 n/a
Download CSV