Transcript: Human NM_015905.3

Homo sapiens tripartite motif containing 24 (TRIM24), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
TRIM24 (8805)
Length:
8488
CDS:
291..3443

Additional Resources:

NCBI RefSeq record:
NM_015905.3
NBCI Gene record:
TRIM24 (8805)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148301 ATGCATCACACCTTGCACGA pXPR_003 AGG 1172 37% 8 0.6008 TRIM24 TRIM24 77888
2 BRDN0001146855 GGCAACGAATGACTCCAACT pXPR_003 GGG 365 12% 2 0.5864 TRIM24 TRIM24 77886
3 BRDN0001147238 CTGCTGCACTAGTAATCGTG pXPR_003 GGG 1775 56% 11 0.4535 TRIM24 TRIM24 77889
4 BRDN0001145637 GCACTAGGTGAACGTATTGG pXPR_003 GGG 2046 65% 13 0.3332 TRIM24 TRIM24 77887
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195528 CGACTGATTACATACCGGTTA pLKO.1 1428 CDS 100% 4.050 5.670 N TRIM24 n/a
2 TRCN0000021259 CGCATGAAACTTATGCAACAA pLKO.1 1305 CDS 100% 4.950 3.960 N TRIM24 n/a
3 TRCN0000319200 CGCATGAAACTTATGCAACAA pLKO_005 1305 CDS 100% 4.950 3.960 N TRIM24 n/a
4 TRCN0000194983 CCATTTCTGTTAACCTCTTAT pLKO.1 3595 3UTR 100% 13.200 9.240 N TRIM24 n/a
5 TRCN0000088522 CCTCTAACTGTGCCTGATTAT pLKO.1 3075 CDS 100% 13.200 9.240 N Trim24 n/a
6 TRCN0000195174 CCTTGTTAAGTTAACACCTAT pLKO.1 2978 CDS 100% 4.950 3.465 N TRIM24 n/a
7 TRCN0000021260 CCATGAAATGAGCCTGGCTTT pLKO.1 3041 CDS 100% 4.050 2.835 N TRIM24 n/a
8 TRCN0000319203 CCATGAAATGAGCCTGGCTTT pLKO_005 3041 CDS 100% 4.050 2.835 N TRIM24 n/a
9 TRCN0000021263 CGAGACTTATCTAAACCAGAA pLKO.1 2901 CDS 100% 4.050 2.835 N TRIM24 n/a
10 TRCN0000021261 CCTGTTGTTATAGTGAAGCAA pLKO.1 2496 CDS 100% 3.000 2.100 N TRIM24 n/a
11 TRCN0000319211 CCTGTTGTTATAGTGAAGCAA pLKO_005 2496 CDS 100% 3.000 2.100 N TRIM24 n/a
12 TRCN0000021262 GCAGCAGTACAGCATTACTTT pLKO.1 1399 CDS 100% 5.625 3.375 N TRIM24 n/a
13 TRCN0000319201 GCAGCAGTACAGCATTACTTT pLKO_005 1399 CDS 100% 5.625 3.375 N TRIM24 n/a
14 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7234 3UTR 100% 4.950 2.475 Y CFLAR n/a
15 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7234 3UTR 100% 4.950 2.475 Y C19orf31 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6930 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000088520 CCCAAGTTGGAGTCATTCGAT pLKO.1 649 CDS 100% 3.000 2.400 N Trim24 n/a
18 TRCN0000288036 CCCAAGTTGGAGTCATTCGAT pLKO_005 649 CDS 100% 3.000 2.400 N Trim24 n/a
19 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 6997 3UTR 100% 13.200 6.600 Y IQCC n/a
20 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6931 3UTR 100% 13.200 6.600 Y LIAS n/a
21 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7232 3UTR 100% 4.950 2.475 Y ERN2 n/a
22 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7232 3UTR 100% 4.950 2.475 Y P3H4 n/a
23 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7232 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489756 ACGCGTAAGGTGTACTAGAAAATC pLX_317 11.5% 99.9% 100% V5 (not translated due to prior stop codon) 1161G>A n/a
Download CSV