Transcript: Human NM_016128.4

Homo sapiens COPI coat complex subunit gamma 1 (COPG1), mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
COPG1 (22820)
Length:
3078
CDS:
105..2729

Additional Resources:

NCBI RefSeq record:
NM_016128.4
NBCI Gene record:
COPG1 (22820)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016128.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380994 GAGGGTGGCTTTGAGTATAAG pLKO_005 1326 CDS 100% 13.200 18.480 N COPG1 n/a
2 TRCN0000382101 GTACATCCGCTTCATCTATAA pLKO_005 1517 CDS 100% 13.200 18.480 N COPG1 n/a
3 TRCN0000379865 TCGCAAACACGCCGTCCTTAT pLKO_005 1277 CDS 100% 10.800 15.120 N COPG1 n/a
4 TRCN0000148567 CCTAGCCGTCAATAAGATGAT pLKO.1 728 CDS 100% 4.950 6.930 N COPG1 n/a
5 TRCN0000148879 CCTCAATAAGGTTGCCATGAA pLKO.1 1034 CDS 100% 4.950 6.930 N COPG1 n/a
6 TRCN0000149110 GAGGCCCGTGTATTTAATGAA pLKO.1 192 CDS 100% 5.625 4.500 N COPG1 n/a
7 TRCN0000380828 AGCACGAGATGGTGGTGTATG pLKO_005 889 CDS 100% 10.800 7.560 N COPG1 n/a
8 TRCN0000380046 GTCAGACAAAGTGCCGGATAA pLKO_005 2549 CDS 100% 10.800 7.560 N COPG1 n/a
9 TRCN0000379623 TCCCATCAACCCTCGGAAATG pLKO_005 215 CDS 100% 10.800 7.560 N COPG1 n/a
10 TRCN0000146530 GCAGGCTATATCCTAAATGGT pLKO.1 1734 CDS 100% 3.000 2.100 N COPG1 n/a
11 TRCN0000147540 GATGAATTTGAGAAGGAGGAA pLKO.1 2445 CDS 100% 2.640 1.848 N COPG1 n/a
12 TRCN0000149699 GCTTGTCCTAAATCTTGCTGT pLKO.1 2944 3UTR 100% 2.640 1.848 N COPG1 n/a
13 TRCN0000382054 TTACTGTAGCTGATCACATTC pLKO_005 2377 CDS 100% 10.800 6.480 N COPG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016128.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02687 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02687 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476630 AGGGAACATCTGTCAGTAAATACC pLX_317 16.1% 100% 100% V5 n/a
Download CSV