Transcript: Human NM_016213.5

Homo sapiens thyroid hormone receptor interactor 4 (TRIP4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
TRIP4 (9325)
Length:
2013
CDS:
29..1774

Additional Resources:

NCBI RefSeq record:
NM_016213.5
NBCI Gene record:
TRIP4 (9325)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016213.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022136 CAGGCTACATATCGTCTTCTT pLKO.1 1481 CDS 100% 4.950 6.930 N TRIP4 n/a
2 TRCN0000022137 CGGAAGACTTTCGGCCTGGAT pLKO.1 89 CDS 100% 0.880 0.704 N TRIP4 n/a
3 TRCN0000022138 CCTTTGGGAGTTCTGGTAAAT pLKO.1 1151 CDS 100% 13.200 9.240 N TRIP4 n/a
4 TRCN0000285344 CTGGGCTGTGTGGACCTAATT pLKO_005 1550 CDS 100% 13.200 9.240 N TRIP4 n/a
5 TRCN0000275292 GAAATCAGGCGACCATCTAAA pLKO_005 316 CDS 100% 13.200 9.240 N TRIP4 n/a
6 TRCN0000275338 GGACTAGAGTTCAACTCATTT pLKO_005 1256 CDS 100% 13.200 9.240 N TRIP4 n/a
7 TRCN0000275339 TGGAATTGAAGTAGTAGAAAC pLKO_005 1843 3UTR 100% 10.800 7.560 N TRIP4 n/a
8 TRCN0000022135 GCAGAGTATCATAGCAGACTA pLKO.1 1055 CDS 100% 4.950 3.465 N TRIP4 n/a
9 TRCN0000275290 GCAGAGTATCATAGCAGACTA pLKO_005 1055 CDS 100% 4.950 3.465 N TRIP4 n/a
10 TRCN0000022134 CCTCATCAAGAATTGCGAATT pLKO.1 773 CDS 100% 0.000 0.000 N TRIP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016213.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07388 pDONR223 100% 99.8% 100% None 1258T>C;1596G>A n/a
2 ccsbBroad304_07388 pLX_304 0% 99.8% 100% V5 1258T>C;1596G>A n/a
3 TRCN0000480651 TCTCTGACGTCAGCACCCCTAAAA pLX_317 23.9% 99.8% 100% V5 1258T>C;1596G>A n/a
Download CSV