Transcript: Human NM_016237.5

Homo sapiens anaphase promoting complex subunit 5 (ANAPC5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
ANAPC5 (51433)
Length:
2574
CDS:
72..2339

Additional Resources:

NCBI RefSeq record:
NM_016237.5
NBCI Gene record:
ANAPC5 (51433)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016237.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088404 GCCCAGATATTACACTGTCAA pLKO.1 280 CDS 100% 4.950 6.930 N Anapc5 n/a
2 TRCN0000325254 GCCCAGATATTACACTGTCAA pLKO_005 280 CDS 100% 4.950 6.930 N Anapc5 n/a
3 TRCN0000004155 GCAATGAATGATGGCAAATAT pLKO.1 1626 CDS 100% 15.000 10.500 N ANAPC5 n/a
4 TRCN0000277760 GCAATGAATGATGGCAAATAT pLKO_005 1626 CDS 100% 15.000 10.500 N ANAPC5 n/a
5 TRCN0000087995 GCACTGTTTGAGCTGGCTTTA pLKO.1 1094 CDS 100% 10.800 7.560 N Gm10482 n/a
6 TRCN0000004156 GCTAAAGAATGATGAGACTAA pLKO.1 737 CDS 100% 4.950 3.465 N ANAPC5 n/a
7 TRCN0000277833 GCTAAAGAATGATGAGACTAA pLKO_005 737 CDS 100% 4.950 3.465 N ANAPC5 n/a
8 TRCN0000004152 TCTCTCCCTATAAATGATGTA pLKO.1 2401 3UTR 100% 4.950 3.465 N ANAPC5 n/a
9 TRCN0000277832 TCTCTCCCTATAAATGATGTA pLKO_005 2401 3UTR 100% 4.950 3.465 N ANAPC5 n/a
10 TRCN0000004154 GCAGAACAACACAGAGTCCTT pLKO.1 1448 CDS 100% 2.640 1.848 N ANAPC5 n/a
11 TRCN0000277835 GCAGAACAACACAGAGTCCTT pLKO_005 1448 CDS 100% 2.640 1.848 N ANAPC5 n/a
12 TRCN0000004153 CCAGTAGAGATGAGGGTGAAA pLKO.1 604 CDS 100% 4.950 2.970 N ANAPC5 n/a
13 TRCN0000277759 CCAGTAGAGATGAGGGTGAAA pLKO_005 604 CDS 100% 4.950 2.970 N ANAPC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016237.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03305 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03305 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470872 ATTGACGTCAGGCGACGCTCCCAT pLX_317 18.2% 100% 100% V5 n/a
4 ccsbBroadEn_15839 pDONR223 0% 99.9% 100% None 1525C>T n/a
5 ccsbBroad304_15839 pLX_304 0% 99.9% 100% V5 1525C>T n/a
6 TRCN0000469244 GTTCACACACCAAGACTTGCGCAA pLX_317 18.2% 99.9% 100% V5 1525C>T n/a
Download CSV