Transcript: Human NM_016580.3

Homo sapiens protocadherin 12 (PCDH12), mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
PCDH12 (51294)
Length:
6579
CDS:
1212..4766

Additional Resources:

NCBI RefSeq record:
NM_016580.3
NBCI Gene record:
PCDH12 (51294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423502 GTTGCTCACTTAGTAGCTATT pLKO_005 2721 CDS 100% 10.800 15.120 N PCDH12 n/a
2 TRCN0000434363 GACGGTTTGTGGCTGAGATAA pLKO_005 4983 3UTR 100% 13.200 10.560 N PCDH12 n/a
3 TRCN0000053916 CCTCTTGGATGCCAATGATAA pLKO.1 2873 CDS 100% 13.200 9.240 N PCDH12 n/a
4 TRCN0000053917 GACAGGGAAATCCATTCATTT pLKO.1 1818 CDS 100% 13.200 9.240 N PCDH12 n/a
5 TRCN0000053913 GAGAACTTTAGGGTGACTGAT pLKO.1 4868 3UTR 100% 4.950 3.465 N PCDH12 n/a
6 TRCN0000174163 GAGAACTTTAGGGTGACTGAT pLKO.1 4868 3UTR 100% 4.950 3.465 N PCDH12 n/a
7 TRCN0000053914 GCACTGGAAATCCAAGAAGAT pLKO.1 1959 CDS 100% 4.950 3.465 N PCDH12 n/a
8 TRCN0000174162 GCACTGGAAATCCAAGAAGAT pLKO.1 1959 CDS 100% 4.950 3.465 N PCDH12 n/a
9 TRCN0000053915 CCTGGCTTTGTTCATGTCCAT pLKO.1 3407 CDS 100% 2.640 1.848 N PCDH12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016580.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10458 pDONR223 100% 99.5% 99.5% None (many diffs) n/a
2 ccsbBroad304_10458 pLX_304 0% 99.5% 99.5% V5 (many diffs) n/a
3 TRCN0000479352 GCTACTAAGTCCAAACTACTGTTT pLX_317 14.2% 99.5% 99.5% V5 (many diffs) n/a
Download CSV