Transcript: Human NM_016602.3

Homo sapiens C-C motif chemokine receptor 10 (CCR10), mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
CCR10 (2826)
Length:
1773
CDS:
21..1109

Additional Resources:

NCBI RefSeq record:
NM_016602.3
NBCI Gene record:
CCR10 (2826)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008836 GAGCTTTGCTACAAGGCCGAT pLKO.1 105 CDS 100% 2.160 3.024 N CCR10 n/a
2 TRCN0000008838 CTGCTGGATACTGCCGATCTA pLKO.1 822 CDS 100% 4.950 3.960 N CCR10 n/a
3 TRCN0000357132 TTCCTCTTCCTGGCCTGTATC pLKO_005 402 CDS 100% 10.800 7.560 N CCR10 n/a
4 TRCN0000008837 CAGTCTCTCCTGGGACAACTA pLKO.1 1088 CDS 100% 4.950 3.465 N CCR10 n/a
5 TRCN0000357203 TGCTGGATACTGCCGATCTAC pLKO_005 823 CDS 100% 4.950 3.465 N CCR10 n/a
6 TRCN0000357131 TGGCCTCAATCCCGTTCTCTA pLKO_005 929 CDS 100% 4.950 3.465 N CCR10 n/a
7 TRCN0000008835 CCTGCCAGCAAACGCAAGGAT pLKO.1 867 CDS 100% 1.000 0.700 N CCR10 n/a
8 TRCN0000008839 CCTGGCCTGTATCAGCGCCGA pLKO.1 410 CDS 100% 0.000 0.000 N CCR10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016602.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488243 AGGAGCCCTGGTGGGTTTCCGCCG pLX_317 30% 100% 100% V5 (not translated due to prior stop codon) n/a
2 TRCN0000488260 CTTGCCTTCCACCGGTTGCGGGCA pLX_317 30% 99.9% 99.7% V5 1086_1087insG n/a
Download CSV