Transcript: Human NM_016628.5

Homo sapiens WW domain containing adaptor with coiled-coil (WAC), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
WAC (51322)
Length:
5912
CDS:
463..2406

Additional Resources:

NCBI RefSeq record:
NM_016628.5
NBCI Gene record:
WAC (51322)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016628.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273664 ATGTATCCTTCACGTTGTAAA pLKO_005 2611 3UTR 100% 13.200 18.480 N WAC n/a
2 TRCN0000135667 GCATCAAGATTACGCGAAGAA pLKO.1 2209 CDS 100% 4.950 6.930 N WAC n/a
3 TRCN0000135994 GCAGTGATTGAGCATAACCTA pLKO.1 3112 3UTR 100% 3.000 4.200 N WAC n/a
4 TRCN0000135201 CTCAAACTAACACAGTCCCTA pLKO.1 1835 CDS 100% 2.640 3.696 N WAC n/a
5 TRCN0000138407 CGGAGATCTGATAGTCCTGAA pLKO.1 640 CDS 100% 4.050 3.240 N WAC n/a
6 TRCN0000273610 CGGAGATCTGATAGTCCTGAA pLKO_005 640 CDS 100% 4.050 3.240 N WAC n/a
7 TRCN0000345721 CAATGCTGAGGTGGCTAAATA pLKO_005 2696 3UTR 100% 15.000 10.500 N Wac n/a
8 TRCN0000273609 CTATTCACATGTCCGAAATTT pLKO_005 2246 CDS 100% 15.000 10.500 N WAC n/a
9 TRCN0000273608 GCGAGAGCAAAGGATACTATT pLKO_005 2325 CDS 100% 13.200 9.240 N WAC n/a
10 TRCN0000193841 CCAGTTACTCTCCACAAGAAA pLKO.1 740 CDS 100% 5.625 3.938 N Wac n/a
11 TRCN0000345718 CCAGTTACTCTCCACAAGAAA pLKO_005 740 CDS 100% 5.625 3.938 N Wac n/a
12 TRCN0000133639 GTCGAACAGAAGTTTCACAAT pLKO.1 911 CDS 100% 4.950 3.465 N WAC n/a
13 TRCN0000273607 GTCGAACAGAAGTTTCACAAT pLKO_005 911 CDS 100% 4.950 3.465 N WAC n/a
14 TRCN0000137728 GCCATCTAATCAGTCTCCGAT pLKO.1 1755 CDS 100% 2.640 1.848 N WAC n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4934 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4934 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016628.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11974 pDONR223 100% 99.4% 98.7% None 1917_1918delAA;1941_1942insTGAAGATG n/a
2 ccsbBroad304_11974 pLX_304 0% 99.4% 98.7% V5 1917_1918delAA;1941_1942insTGAAGATG n/a
3 TRCN0000480363 TCCTATGTCTCACCCTGGACAAAC pLX_317 23.5% 99.4% 98.7% V5 1917_1918delAA;1941_1942insTGAAGATG n/a
Download CSV