Transcript: Mouse NM_016722.4

Mus musculus galactosamine (N-acetyl)-6-sulfate sulfatase (Galns), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Galns (50917)
Length:
2593
CDS:
150..1712

Additional Resources:

NCBI RefSeq record:
NM_016722.4
NBCI Gene record:
Galns (50917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294888 GGCGATGCTGTTCGGGAAATA pLKO_005 906 CDS 100% 13.200 18.480 N Galns n/a
2 TRCN0000101807 GCTACTGCTCATGGACGATAT pLKO.1 242 CDS 100% 10.800 15.120 N Galns n/a
3 TRCN0000287395 GCTACTGCTCATGGACGATAT pLKO_005 242 CDS 100% 10.800 15.120 N Galns n/a
4 TRCN0000101806 GCATGGATTTGACGAGTGGTT pLKO.1 599 CDS 100% 2.640 3.696 N Galns n/a
5 TRCN0000318119 GCATGGATTTGACGAGTGGTT pLKO_005 599 CDS 100% 2.640 3.696 N Galns n/a
6 TRCN0000101805 CCCTGCATACATTTCAACCTA pLKO.1 1990 3UTR 100% 3.000 2.100 N Galns n/a
7 TRCN0000287393 CCCTGCATACATTTCAACCTA pLKO_005 1990 3UTR 100% 3.000 2.100 N Galns n/a
8 TRCN0000101809 GCTTCTATTCTGCCAACCCTT pLKO.1 352 CDS 100% 2.640 1.848 N Galns n/a
9 TRCN0000287394 GCTTCTATTCTGCCAACCCTT pLKO_005 352 CDS 100% 2.640 1.848 N Galns n/a
10 TRCN0000101808 GAAGTGTTTCTGGGCCCATTA pLKO.1 1691 CDS 100% 10.800 6.480 N Galns n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016722.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00612 pDONR223 100% 83.5% 85% None (many diffs) n/a
2 ccsbBroad304_00612 pLX_304 0% 83.5% 85% V5 (many diffs) n/a
3 TRCN0000468878 AAGAAAGTACTACATAAAATAACC pLX_317 29.1% 83.5% 85% V5 (many diffs) n/a
Download CSV