Transcript: Mouse NM_016897.3

Mus musculus translocase of inner mitochondrial membrane 23 (Timm23), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Timm23 (53600)
Length:
1162
CDS:
144..773

Additional Resources:

NCBI RefSeq record:
NM_016897.3
NBCI Gene record:
Timm23 (53600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_016897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445750 GGGTTACTCGAACGCTGATTT pLKO_005 215 CDS 100% 13.200 18.480 N Timm23 n/a
2 TRCN0000114248 CGGTCTTCGTTTAGGATTGAA pLKO.1 425 CDS 100% 5.625 7.875 N Timm23 n/a
3 TRCN0000441583 AGGAGCACTTTGGGCTAATAC pLKO_005 512 CDS 100% 13.200 10.560 N Timm23 n/a
4 TRCN0000114250 CCACGCTATCTCGTTCAGGAT pLKO.1 291 CDS 100% 2.640 2.112 N Timm23 n/a
5 TRCN0000114249 CCAGTCTCTATGCACTGTATA pLKO.1 706 CDS 100% 13.200 9.240 N Timm23 n/a
6 TRCN0000114247 GCCTGGTCCAAACCAAGAAAT pLKO.1 462 CDS 100% 13.200 9.240 N Timm23 n/a
7 TRCN0000441664 ACAGGTGGTCTTCGAGGAATA pLKO_005 654 CDS 100% 10.800 7.560 N Timm23 n/a
8 TRCN0000114246 GCTGTGACAAAGATCATGGAT pLKO.1 897 3UTR 100% 3.000 2.100 N Timm23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016897.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02428 pDONR223 100% 90.6% 97.1% None (many diffs) n/a
2 ccsbBroad304_02428 pLX_304 0% 90.6% 97.1% V5 (many diffs) n/a
3 ccsbBroadEn_11498 pDONR223 100% 90.1% 96.6% None (many diffs) n/a
4 ccsbBroad304_11498 pLX_304 0% 90.1% 96.6% V5 (many diffs) n/a
5 TRCN0000471893 GGGCTAAATTTTAGCTTGGTCAGC pLX_317 74.2% 90.1% 96.6% V5 (many diffs) n/a
Download CSV