Transcript: Mouse NM_017376.3

Mus musculus thyrotroph embryonic factor (Tef), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Tef (21685)
Length:
4267
CDS:
157..1062

Additional Resources:

NCBI RefSeq record:
NM_017376.3
NBCI Gene record:
Tef (21685)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311031 ATCTACGTAGACGGGTAAATG pLKO_005 1278 3UTR 100% 13.200 18.480 N Tef n/a
2 TRCN0000086003 CCGCCGTATATGAGTTGTATT pLKO.1 2159 3UTR 100% 13.200 18.480 N Tef n/a
3 TRCN0000374330 CTCACGTCTCAGCTTCATTAT pLKO_005 1189 3UTR 100% 13.200 18.480 N Tef n/a
4 TRCN0000086007 CGTAAGAAGAACAATGTGGCA pLKO.1 868 CDS 100% 0.660 0.528 N Tef n/a
5 TRCN0000331525 CGTAAGAAGAACAATGTGGCA pLKO_005 868 CDS 100% 0.660 0.528 N Tef n/a
6 TRCN0000086005 GTATTGGACAAGACGTAAGAA pLKO.1 855 CDS 100% 5.625 3.938 N Tef n/a
7 TRCN0000301986 GTATTGGACAAGACGTAAGAA pLKO_005 855 CDS 100% 5.625 3.938 N Tef n/a
8 TRCN0000086004 GCACAGAATCGTCCTTGGAAA pLKO.1 620 CDS 100% 4.950 3.465 N Tef n/a
9 TRCN0000301997 GCACAGAATCGTCCTTGGAAA pLKO_005 620 CDS 100% 4.950 3.465 N Tef n/a
10 TRCN0000086006 AGCACAGAATCGTCCTTGGAA pLKO.1 619 CDS 100% 3.000 2.100 N Tef n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017376.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07046 pDONR223 100% 89.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_07046 pLX_304 0% 89.6% 95.7% V5 (many diffs) n/a
3 TRCN0000472817 CCTAAATAGATCCTATTGTTCCAC pLX_317 37.8% 89.6% 95.7% V5 (many diffs) n/a
Download CSV