Transcript: Mouse NM_017472.4

Mus musculus sorting nexin 3 (Snx3), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Snx3 (54198)
Length:
1377
CDS:
278..766

Additional Resources:

NCBI RefSeq record:
NM_017472.4
NBCI Gene record:
Snx3 (54198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093602 GCTGGAACAGTTCATAAACAA pLKO.1 640 CDS 100% 5.625 7.875 N Snx3 n/a
2 TRCN0000317568 GCTGGAACAGTTCATAAACAA pLKO_005 640 CDS 100% 5.625 7.875 N Snx3 n/a
3 TRCN0000381824 GAGATCAGGGTCAAGACAAAT pLKO_005 425 CDS 100% 13.200 9.240 N Snx3 n/a
4 TRCN0000381963 TCATCACCAAGCCGCAGAATC pLKO_005 309 CDS 100% 10.800 7.560 N Snx3 n/a
5 TRCN0000150807 GAACGTTGTCTTCACATGTTT pLKO.1 689 CDS 100% 5.625 3.938 N SNX3 n/a
6 TRCN0000352802 GAACGTTGTCTTCACATGTTT pLKO_005 689 CDS 100% 5.625 3.938 N SNX3 n/a
7 TRCN0000093599 GCACCAATGAAGAAGTTGTAA pLKO.1 812 3UTR 100% 5.625 3.938 N Snx3 n/a
8 TRCN0000317491 GCACCAATGAAGAAGTTGTAA pLKO_005 812 3UTR 100% 5.625 3.938 N Snx3 n/a
9 TRCN0000093603 AGAGAGAGCAAGGTTGTAGTT pLKO.1 524 CDS 100% 4.950 3.465 N Snx3 n/a
10 TRCN0000317488 AGAGAGAGCAAGGTTGTAGTT pLKO_005 524 CDS 100% 4.950 3.465 N Snx3 n/a
11 TRCN0000093600 GCCCAGAATGAACGTTGTCTT pLKO.1 680 CDS 100% 4.950 3.465 N Snx3 n/a
12 TRCN0000317569 GCCCAGAATGAACGTTGTCTT pLKO_005 680 CDS 100% 4.950 3.465 N Snx3 n/a
13 TRCN0000093601 GCAGAATCTGAATGACGCCTA pLKO.1 322 CDS 100% 2.160 1.512 N Snx3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017472.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02001 pDONR223 100% 93.4% 100% None (many diffs) n/a
2 ccsbBroad304_02001 pLX_304 0% 93.4% 100% V5 (many diffs) n/a
3 TRCN0000471181 ATACTGTTTACAGTACCGCGCAGT pLX_317 84.5% 93.4% 100% V5 (many diffs) n/a
4 ccsbBroadEn_14002 pDONR223 100% 61.8% 54.1% None (many diffs) n/a
5 ccsbBroad304_14002 pLX_304 0% 61.8% 54.1% V5 (many diffs) n/a
6 TRCN0000469215 TTAGGTTACCGGTGGACTGATAGC pLX_317 100% 61.8% 54.1% V5 (many diffs) n/a
Download CSV