Transcript: Mouse NM_017477.2

Mus musculus coatomer protein complex, subunit gamma 1 (Copg1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Copg1 (54161)
Length:
4014
CDS:
97..2721

Additional Resources:

NCBI RefSeq record:
NM_017477.2
NBCI Gene record:
Copg1 (54161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_017477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100762 CCGCATGTGCTATTTGACCAT pLKO.1 351 CDS 100% 2.640 3.696 N Copg1 n/a
2 TRCN0000317735 CCGCATGTGCTATTTGACCAT pLKO_005 351 CDS 100% 2.640 3.696 N Copg1 n/a
3 TRCN0000100764 GCTCGGGTCTTTAACGAAACT pLKO.1 187 CDS 100% 4.950 3.960 N Copg1 n/a
4 TRCN0000319473 CCAAGAGGCTCGGGTCTTTAA pLKO_005 180 CDS 100% 13.200 9.240 N Copg1 n/a
5 TRCN0000100761 CCAAGATCCTTTATCTCATAA pLKO.1 242 CDS 100% 13.200 9.240 N Copg1 n/a
6 TRCN0000317734 CCAAGATCCTTTATCTCATAA pLKO_005 242 CDS 100% 13.200 9.240 N Copg1 n/a
7 TRCN0000100763 GAAGCAACTGAGGCTTTCTTT pLKO.1 289 CDS 100% 5.625 3.938 N Copg1 n/a
8 TRCN0000349522 GAAGCAACTGAGGCTTTCTTT pLKO_005 289 CDS 100% 5.625 3.938 N Copg1 n/a
9 TRCN0000147540 GATGAATTTGAGAAGGAGGAA pLKO.1 2437 CDS 100% 2.640 1.848 N COPG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017477.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02687 pDONR223 100% 89.1% 97.2% None (many diffs) n/a
2 ccsbBroad304_02687 pLX_304 0% 89.1% 97.2% V5 (many diffs) n/a
3 TRCN0000476630 AGGGAACATCTGTCAGTAAATACC pLX_317 16.1% 89.1% 97.2% V5 (many diffs) n/a
Download CSV