Transcript: Human NM_017551.3

Homo sapiens glutamate ionotropic receptor delta type subunit 1 (GRID1), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
GRID1 (2894)
Length:
6154
CDS:
404..3433

Additional Resources:

NCBI RefSeq record:
NM_017551.3
NBCI Gene record:
GRID1 (2894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063037 GCACTACCTATAGTGAGACTT pLKO.1 1596 CDS 100% 0.495 0.693 N GRID1 n/a
2 TRCN0000063036 CAAGAACATTAGCCACGTATT pLKO.1 997 CDS 100% 10.800 7.560 N GRID1 n/a
3 TRCN0000063035 CCCTCTTTGCTCCATTTGATT pLKO.1 2070 CDS 100% 5.625 3.938 N GRID1 n/a
4 TRCN0000063033 CGCTACAAAGGGTTCTCCATA pLKO.1 1787 CDS 100% 4.950 3.465 N GRID1 n/a
5 TRCN0000063034 GCAAATCTTTCCGTCTGCAAA pLKO.1 1249 CDS 100% 4.950 3.465 N GRID1 n/a
6 TRCN0000103044 CGAGTATGATATCCGTGGGTT pLKO.1 916 CDS 100% 2.640 1.848 N Grid1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017551.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13863 pDONR223 100% 60.3% 60.2% None 5A>T;1828_3027del n/a
2 ccsbBroad304_13863 pLX_304 0% 60.3% 60.2% V5 5A>T;1828_3027del n/a
3 TRCN0000471140 AGGCCAAGTCGTGTTGCGCGTACC pLX_317 18.4% 60.3% 60.2% V5 5A>T;1828_3027del n/a
4 ccsbBroadEn_10861 pDONR223 100% 12.8% 12.8% None 1_2637del n/a
5 ccsbBroad304_10861 pLX_304 0% 12.8% 12.8% V5 1_2637del n/a
6 TRCN0000467504 GGTCGTTCCCTAAGCAGGAAGAAT pLX_317 95.1% 12.8% 12.8% V5 1_2637del n/a
Download CSV