Transcript: Human NM_017643.3

Homo sapiens mbt domain containing 1 (MBTD1), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MBTD1 (54799)
Length:
5365
CDS:
328..2214

Additional Resources:

NCBI RefSeq record:
NM_017643.3
NBCI Gene record:
MBTD1 (54799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151070 GCCACAGTAACTCGAATTATT pLKO.1 1861 CDS 100% 15.000 21.000 N MBTD1 n/a
2 TRCN0000323079 GCCACAGTAACTCGAATTATT pLKO_005 1861 CDS 100% 15.000 21.000 N MBTD1 n/a
3 TRCN0000323080 GCCCATTAATACATCATATTG pLKO_005 1331 CDS 100% 13.200 18.480 N MBTD1 n/a
4 TRCN0000150313 CTCCTAGAACTATTCAGCATA pLKO.1 1058 CDS 100% 4.950 3.960 N MBTD1 n/a
5 TRCN0000154234 CCTCCTAGAACTATTCAGCAT pLKO.1 1057 CDS 100% 2.640 2.112 N MBTD1 n/a
6 TRCN0000323082 GGAAGCTATAGACCCATTAAA pLKO_005 1497 CDS 100% 15.000 10.500 N MBTD1 n/a
7 TRCN0000323011 TCTCATGGAGCCACGTTTAAT pLKO_005 1833 CDS 100% 15.000 10.500 N MBTD1 n/a
8 TRCN0000323084 TGGATTTATGTGCATTGTTAA pLKO_005 2472 3UTR 100% 13.200 9.240 N MBTD1 n/a
9 TRCN0000097657 CGTGTAGGAATGAAATTAGAA pLKO.1 1804 CDS 100% 5.625 3.938 N Mbtd1 n/a
10 TRCN0000097655 GCAGGATTGAAGGAAATGATT pLKO.1 2539 3UTR 100% 5.625 3.938 N Mbtd1 n/a
11 TRCN0000152974 GCAACCATTAGAAAGGTGCTA pLKO.1 1537 CDS 100% 2.640 1.848 N MBTD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017643.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12084 pDONR223 100% 64.6% 63.3% None (many diffs) n/a
2 ccsbBroad304_12084 pLX_304 0% 64.6% 63.3% V5 (many diffs) n/a
3 TRCN0000479991 GTTTCTTTAGCCCCGACTGTGCAG pLX_317 25.9% 64.6% 63.3% V5 (many diffs) n/a
Download CSV