Transcript: Human NM_017657.5

Homo sapiens aftiphilin (AFTPH), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
AFTPH (54812)
Length:
4017
CDS:
318..3047

Additional Resources:

NCBI RefSeq record:
NM_017657.5
NBCI Gene record:
AFTPH (54812)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017657.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121761 CGGAGTTGTATGAGTTAACAA pLKO.1 2782 CDS 100% 5.625 4.500 N AFTPH n/a
2 TRCN0000277410 TAGATAGCCTTACAAGCTTTA pLKO_005 541 CDS 100% 10.800 7.560 N Aftph n/a
3 TRCN0000193718 CCTGTTATAGTGCCCATGTAT pLKO.1 2556 CDS 100% 5.625 3.938 N Aftph n/a
4 TRCN0000144628 GTTCTCCCAAAGAAGAAAGTA pLKO.1 1459 CDS 100% 5.625 3.938 N AFTPH n/a
5 TRCN0000143370 GCAATAAGAAGCAGCCTGTTA pLKO.1 2542 CDS 100% 4.950 3.465 N AFTPH n/a
6 TRCN0000141312 CCTTCCATACTTGTCCCTGAT pLKO.1 2298 CDS 100% 4.050 2.835 N AFTPH n/a
7 TRCN0000343981 CCTTCCATACTTGTCCCTGAT pLKO_005 2298 CDS 100% 4.050 2.835 N AFTPH n/a
8 TRCN0000143463 GATAAGGACATCACTGCTGAA pLKO.1 582 CDS 100% 4.050 2.835 N AFTPH n/a
9 TRCN0000122139 GCTGATAATTCAGAAGCCATT pLKO.1 1338 CDS 100% 4.050 2.835 N AFTPH n/a
10 TRCN0000145033 GTTGATTTCGATACACCAGAT pLKO.1 450 CDS 100% 4.050 2.835 N AFTPH n/a
11 TRCN0000343978 GTTGATTTCGATACACCAGAT pLKO_005 450 CDS 100% 4.050 2.835 N AFTPH n/a
12 TRCN0000142334 CCACTTCAGTTCAGACAGCTT pLKO.1 2239 CDS 100% 2.640 1.848 N AFTPH n/a
13 TRCN0000143340 GCATAGTGACTAACAGAGGTT pLKO.1 1225 CDS 100% 2.640 1.848 N AFTPH n/a
14 TRCN0000343980 GCATAGTGACTAACAGAGGTT pLKO_005 1225 CDS 100% 2.640 1.848 N AFTPH n/a
15 TRCN0000121961 CTTCCATTGATGGCATGGAAA pLKO.1 685 CDS 100% 0.495 0.347 N AFTPH n/a
16 TRCN0000344048 CTTCCATTGATGGCATGGAAA pLKO_005 685 CDS 100% 0.495 0.347 N AFTPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017657.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12087 pDONR223 100% 15.1% 15% None (many diffs) n/a
2 ccsbBroad304_12087 pLX_304 0% 15.1% 15% V5 (many diffs) n/a
3 TRCN0000465493 CTCGCACGTAGCCTCCAGTGACCG pLX_317 49.5% 15.1% 15% V5 (many diffs) n/a
Download CSV