Transcript: Human NM_017818.4

Homo sapiens WD repeat containing, antisense to TP73 (WRAP73), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
WRAP73 (49856)
Length:
1692
CDS:
105..1487

Additional Resources:

NCBI RefSeq record:
NM_017818.4
NBCI Gene record:
WRAP73 (49856)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129475 GCATTTAAGCGGAGACTCGAT pLKO.1 1373 CDS 100% 2.640 3.696 N WRAP73 n/a
2 TRCN0000330541 CGACAAGGAACGACAACATTC pLKO_005 1141 CDS 100% 10.800 8.640 N WRAP73 n/a
3 TRCN0000129903 GCCATTAATGATCCCAAGATA pLKO.1 900 CDS 100% 5.625 3.938 N WRAP73 n/a
4 TRCN0000353682 GCCATTAATGATCCCAAGATA pLKO_005 900 CDS 100% 5.625 3.938 N WRAP73 n/a
5 TRCN0000129269 CTCCAGCTTACTCTGCAAGTT pLKO.1 131 CDS 100% 4.950 3.465 N WRAP73 n/a
6 TRCN0000330539 CTCCAGCTTACTCTGCAAGTT pLKO_005 131 CDS 100% 4.950 3.465 N WRAP73 n/a
7 TRCN0000330542 TGCAGAAACAGGGCTACTCTG pLKO_005 1506 3UTR 100% 4.050 2.835 N WRAP73 n/a
8 TRCN0000128440 GCTCAGAGAGTAAATATGAGA pLKO.1 1012 CDS 100% 3.000 2.100 N WRAP73 n/a
9 TRCN0000330540 GCTCAGAGAGTAAATATGAGA pLKO_005 1012 CDS 100% 3.000 2.100 N WRAP73 n/a
10 TRCN0000129630 CAAAGATTACGTGAGCATCTT pLKO.1 572 CDS 100% 0.495 0.347 N WRAP73 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017818.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03140 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03140 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480340 TAGCGTTCTGGATAAGCGCTCGAC pLX_317 31.5% 100% 100% V5 n/a
4 ccsbBroadEn_15811 pDONR223 0% 92.8% 89.9% None (many diffs) n/a
5 ccsbBroad304_15811 pLX_304 0% 92.8% 89.9% V5 (many diffs) n/a
6 TRCN0000473493 GCCACTGTCGCGGTGAAATGTGAT pLX_317 19.1% 92.8% 89.9% V5 (many diffs) n/a
Download CSV