Transcript: Human NM_017847.6

Homo sapiens odr-4 GPCR localization factor homolog (ODR4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ODR4 (54953)
Length:
3820
CDS:
157..1521

Additional Resources:

NCBI RefSeq record:
NM_017847.6
NBCI Gene record:
ODR4 (54953)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017847.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330983 TGTGAAATGCAGAGCTTATAT pLKO_005 1008 CDS 100% 15.000 12.000 N ODR4 n/a
2 TRCN0000331045 GGCAGTAAAGAGGGATATATT pLKO_005 1065 CDS 100% 15.000 10.500 N ODR4 n/a
3 TRCN0000330984 TGCTGCCATGATGCCTATTTG pLKO_005 1629 3UTR 100% 13.200 9.240 N ODR4 n/a
4 TRCN0000136377 CATAGGTGTGATTGCAGCATT pLKO.1 1449 CDS 100% 4.950 3.465 N ODR4 n/a
5 TRCN0000134818 CATGGCTTTCTTTAGAGTGTA pLKO.1 680 CDS 100% 4.950 3.465 N ODR4 n/a
6 TRCN0000134323 GAGGAAATACTCAAGCAACTA pLKO.1 881 CDS 100% 4.950 3.465 N ODR4 n/a
7 TRCN0000330981 GAGGAAATACTCAAGCAACTA pLKO_005 881 CDS 100% 4.950 3.465 N ODR4 n/a
8 TRCN0000136485 CTGCTACTTCTGTCAGCTATA pLKO.1 731 CDS 100% 10.800 6.480 N ODR4 n/a
9 TRCN0000331044 CTGCTACTTCTGTCAGCTATA pLKO_005 731 CDS 100% 10.800 6.480 N ODR4 n/a
10 TRCN0000135254 CAGAGGAAACAAACACAGCTT pLKO.1 1325 CDS 100% 2.640 1.584 N ODR4 n/a
11 TRCN0000136218 GCATTTACAGTTGCAGTCCTT pLKO.1 1465 CDS 100% 2.640 1.584 N ODR4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017847.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12120 pDONR223 100% 82.1% 82.1% None 1_243del n/a
2 ccsbBroad304_12120 pLX_304 0% 82.1% 82.1% V5 1_243del n/a
3 TRCN0000467046 ACCTGGACCTAACAACAGGTACAA pLX_317 30.9% 82.1% 82.1% V5 1_243del n/a
Download CSV