Transcript: Human NM_017886.4

Homo sapiens unc-51 like kinase 4 (ULK4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ULK4 (54986)
Length:
4294
CDS:
137..3964

Additional Resources:

NCBI RefSeq record:
NM_017886.4
NBCI Gene record:
ULK4 (54986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147343 AGAGCGTGTTGTGAATCACA pXPR_003 TGG 1867 49% 20 1.2894 ULK4 ULK4 76011
2 BRDN0001145330 AGAGTTCCACCACTAGCCAG pXPR_003 AGG 215 6% 3 0.9904 ULK4 ULK4 76010
3 BRDN0001145110 CCACCACGCACAAATAGCAA pXPR_003 AGG 1469 38% 15 -0.0275 ULK4 ULK4 76009
4 BRDN0001148283 CCTTTGCCACCTATTCCGAA pXPR_003 AGG 722 19% 7 -0.5403 ULK4 ULK4 76008
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017886.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196468 GCAGTACATGTTGACCTTATT pLKO.1 2257 CDS 100% 13.200 18.480 N ULK4 n/a
2 TRCN0000199192 CCAACTGAGTTTCGGCCTAAG pLKO.1 1157 CDS 100% 6.000 8.400 N ULK4 n/a
3 TRCN0000002202 GACCTGATTAGTGGATTACAT pLKO.1 446 CDS 100% 5.625 4.500 N ULK4 n/a
4 TRCN0000195642 CTTCTCCTCTGACCAAGATTA pLKO.1 1302 CDS 100% 13.200 9.240 N ULK4 n/a
5 TRCN0000199865 GTCCGTCTCACCCGTGAAATA pLKO.1 275 CDS 100% 13.200 9.240 N ULK4 n/a
6 TRCN0000197002 GAAGATCCTTTGCCACCTATT pLKO.1 836 CDS 100% 10.800 7.560 N ULK4 n/a
7 TRCN0000195151 CCATTCTTTGTACTGATAAGT pLKO.1 228 CDS 100% 5.625 3.938 N ULK4 n/a
8 TRCN0000195691 CCTGTTGTTGAGGCAATTGTT pLKO.1 1781 CDS 100% 5.625 3.938 N ULK4 n/a
9 TRCN0000002205 CGACGGAAGGGAACAATCAAT pLKO.1 200 CDS 100% 5.625 3.938 N ULK4 n/a
10 TRCN0000196646 GTGGATTACATCATCTTCATA pLKO.1 456 CDS 100% 5.625 3.938 N ULK4 n/a
11 TRCN0000002206 CAGAAGATGTTGTGAGAGAAT pLKO.1 417 CDS 100% 4.950 3.465 N ULK4 n/a
12 TRCN0000002204 CAGGGCTTTATTACAGGAGAA pLKO.1 2057 CDS 100% 4.050 2.835 N ULK4 n/a
13 TRCN0000002203 CCACTAGGTCACTCTTTCAGA pLKO.1 1127 CDS 100% 3.000 2.100 N ULK4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017886.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12129 pDONR223 100% 44.9% 43.5% None (many diffs) n/a
2 ccsbBroad304_12129 pLX_304 0% 44.9% 43.5% V5 (many diffs) n/a
3 TRCN0000471559 AAACACCGACTGAAGCATACCTCT pLX_317 27.2% 44.9% 43.5% V5 (many diffs) n/a
4 ccsbBroadEn_15087 pDONR223 0% 44.9% 43.5% None (many diffs) n/a
5 ccsbBroad304_15087 pLX_304 0% 44.9% 43.5% V5 (many diffs) n/a
6 TRCN0000467009 ATACCCTGTCGGTTGGTCAATCAC pLX_317 20.3% 44.9% 43.5% V5 (many diffs) n/a
7 TRCN0000489918 CGCTTCGAAGCACGTGGCCACATG pLX_317 21.9% 44.9% 43.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV