Transcript: Human NM_017918.5

Homo sapiens mitochondrial calcium uniporter dominant negative beta subunit (MCUB), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MCUB (55013)
Length:
2230
CDS:
93..1103

Additional Resources:

NCBI RefSeq record:
NM_017918.5
NBCI Gene record:
MCUB (55013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017918.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147905 GCTGTTAAGAGTAGGCAATTT pLKO.1 924 CDS 100% 13.200 18.480 N MCUB n/a
2 TRCN0000128550 GCTTCTACCTTGATGGATATT pLKO.1 456 CDS 100% 13.200 9.240 N MCUB n/a
3 TRCN0000418581 TGCAGCAATACAACAAGTTAA pLKO_005 988 CDS 100% 13.200 9.240 N MCUB n/a
4 TRCN0000435184 GAAGACCTTGCTAAGGCTAAA pLKO_005 1011 CDS 100% 10.800 7.560 N MCUB n/a
5 TRCN0000130052 GCAAGTAGAAGAACTCAATGA pLKO.1 1073 CDS 100% 4.950 3.465 N MCUB n/a
6 TRCN0000148629 CAGCTGTTAAGAGTAGGCAAT pLKO.1 922 CDS 100% 4.050 2.835 N MCUB n/a
7 TRCN0000128649 CATGATTTCAGCTTCTACCTT pLKO.1 446 CDS 100% 3.000 2.100 N MCUB n/a
8 TRCN0000147639 GCAACATGATTTCAGCTTCTA pLKO.1 442 CDS 100% 4.950 2.970 N MCUB n/a
9 TRCN0000216185 CTTCAGTTCTTCCACAAGAAA pLKO.1 945 CDS 100% 0.563 0.338 N Mcub n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017918.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12134 pDONR223 100% 73.7% 73.8% None 1_264del;498T>C n/a
2 ccsbBroad304_12134 pLX_304 0% 73.7% 73.8% V5 1_264del;498T>C n/a
3 TRCN0000470423 TTTAATTGGTCCCGACCCTGACGG pLX_317 54.5% 73.7% 73.8% V5 1_264del;498T>C n/a
Download CSV