Transcript: Human NM_018053.4

Homo sapiens XK related 8 (XKR8), mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
XKR8 (55113)
Length:
2178
CDS:
98..1285

Additional Resources:

NCBI RefSeq record:
NM_018053.4
NBCI Gene record:
XKR8 (55113)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142680 CATGACCCATTTAGCACAGAA pLKO.1 1216 CDS 100% 4.950 3.465 N XKR8 n/a
2 TRCN0000141776 GACCCATTTAGCACAGAAGTT pLKO.1 1219 CDS 100% 4.950 3.465 N XKR8 n/a
3 TRCN0000139576 CAAATGCTAGAAGCCAGGGAT pLKO.1 1877 3UTR 100% 2.640 1.848 N XKR8 n/a
4 TRCN0000142681 CAGGAACATCATTCTGTCCTT pLKO.1 1783 3UTR 100% 2.640 1.848 N XKR8 n/a
5 TRCN0000139094 CCATCCTCTATTTCTCCTGGT pLKO.1 897 CDS 100% 2.160 1.512 N XKR8 n/a
6 TRCN0000139411 CTCTGAGTTTGACTTGGCCTA pLKO.1 442 CDS 100% 2.160 1.512 N XKR8 n/a
7 TRCN0000141625 CAGTTTATGTGCCAGGAACAT pLKO.1 1771 3UTR 100% 4.950 2.970 N XKR8 n/a
8 TRCN0000139980 GCAGTTTATGTGCCAGGAACA pLKO.1 1770 3UTR 100% 4.050 2.430 N XKR8 n/a
9 TRCN0000139470 CGGGTTAGATCCCAAATGCTA pLKO.1 1865 3UTR 100% 3.000 1.800 N XKR8 n/a
10 TRCN0000177915 CATCCTCTATTTCTCCTGGTT pLKO.1 898 CDS 100% 2.640 1.584 N Xkr8 n/a
11 TRCN0000140878 GAGCAGTTTATGTGCCAGGAA pLKO.1 1768 3UTR 100% 2.640 1.584 N XKR8 n/a
12 TRCN0000144061 CCACACCATTCATTCAATTCA pLKO.1 1728 3UTR 100% 5.625 2.813 Y XKR8 n/a
13 TRCN0000141645 CTATTTCTCCTGGTTCAACGT pLKO.1 904 CDS 100% 2.640 1.320 Y XKR8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018053.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03525 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03525 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479642 AAATAACTCATGGGATTTACCAAT pLX_317 26.4% 100% 100% V5 n/a
Download CSV