Transcript: Human NM_018133.4

Homo sapiens MSL complex subunit 2 (MSL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
MSL2 (55167)
Length:
5186
CDS:
1223..2956

Additional Resources:

NCBI RefSeq record:
NM_018133.4
NBCI Gene record:
MSL2 (55167)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018133.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037032 CCTGAACATTCAAATACGATT pLKO.1 1856 CDS 100% 4.950 6.930 N MSL2 n/a
2 TRCN0000037033 CCTTGCTACTCTAACCGCAAA pLKO.1 2666 CDS 100% 4.050 3.240 N MSL2 n/a
3 TRCN0000327864 CCTTGCTACTCTAACCGCAAA pLKO_005 2666 CDS 100% 4.050 3.240 N MSL2 n/a
4 TRCN0000294355 ATGTTCCACAGGCATTGATAT pLKO_005 1960 CDS 100% 13.200 9.240 N MSL2 n/a
5 TRCN0000294354 CAACTCCACCTGCCAACATTA pLKO_005 1396 CDS 100% 13.200 9.240 N MSL2 n/a
6 TRCN0000037031 CCAAGGCGTTTACTGAGATTA pLKO.1 1296 CDS 100% 13.200 9.240 N MSL2 n/a
7 TRCN0000243429 CCCAGTCTCTTAGCCATAATG pLKO_005 2145 CDS 100% 13.200 9.240 N Msl2 n/a
8 TRCN0000294337 CCCAGTCTCTTAGCCATAATG pLKO_005 2145 CDS 100% 13.200 9.240 N MSL2 n/a
9 TRCN0000294296 TTGCCGGAGCTCCTGCATATA pLKO_005 3035 3UTR 100% 13.200 9.240 N MSL2 n/a
10 TRCN0000037030 CGGGATATAATAGAAGCAGTT pLKO.1 1571 CDS 100% 4.050 2.835 N MSL2 n/a
11 TRCN0000037029 CCACTTCCAATTTCTACCATT pLKO.1 2282 CDS 100% 4.950 2.970 N MSL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018133.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03540 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03540 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477741 ATCGTTATCCTTCACCGTTCTGTT pLX_317 18.9% 100% 100% V5 n/a
Download CSV