Transcript: Human NM_018134.3

Homo sapiens IQ motif containing C (IQCC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
IQCC (55721)
Length:
2012
CDS:
12..1412

Additional Resources:

NCBI RefSeq record:
NM_018134.3
NBCI Gene record:
IQCC (55721)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000262828 ACTATACCATGGAGATCAAAG pLKO_005 1302 CDS 100% 10.800 15.120 N IQCC n/a
2 TRCN0000262826 TCTGGACCACCGTCGTCTATA pLKO_005 852 CDS 100% 13.200 10.560 N IQCC n/a
3 TRCN0000262827 GCAGGAGACAGGGTAGCAAAT pLKO_005 225 CDS 100% 10.800 8.640 N IQCC n/a
4 TRCN0000136734 GCCTAGTCATGAAGGACAGAA pLKO.1 1271 CDS 100% 4.950 3.960 N IQCC n/a
5 TRCN0000262825 CAGAGAGCTGGCATGAGTATA pLKO_005 1562 3UTR 100% 13.200 9.240 N IQCC n/a
6 TRCN0000262829 GCACTCTATGAGGACTCAAAT pLKO_005 1041 CDS 100% 13.200 9.240 N IQCC n/a
7 TRCN0000137308 GACGATGGAAGACAGACCTTT pLKO.1 918 CDS 100% 4.950 3.465 N IQCC n/a
8 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1734 3UTR 100% 13.200 6.600 Y IQCC n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1666 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1666 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000137013 CAGGAGATGGAGATTGCAGTA pLKO.1 1858 3UTR 100% 4.050 2.025 Y IQCC n/a
12 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1664 3UTR 100% 4.950 2.475 Y ERN2 n/a
13 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1664 3UTR 100% 4.950 2.475 Y P3H4 n/a
14 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1664 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018134.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03638 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03638 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471753 CAAGAACGAGACGTGAGTAGCACG pLX_317 26.3% 100% 100% V5 n/a
4 ccsbBroadEn_03639 pDONR223 100% 100% 100% None n/a
5 ccsbBroad304_03639 pLX_304 0% 100% 100% V5 n/a
6 TRCN0000477874 CTCAGATCGGACTGATGGTTACTC pLX_317 31.9% 100% 100% V5 n/a
Download CSV