Transcript: Human NM_018351.4

Homo sapiens FYVE, RhoGEF and PH domain containing 6 (FGD6), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
FGD6 (55785)
Length:
9291
CDS:
228..4520

Additional Resources:

NCBI RefSeq record:
NM_018351.4
NBCI Gene record:
FGD6 (55785)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412916 TACGAGAACTTGCCATTTATT pLKO_005 2505 CDS 100% 15.000 21.000 N FGD6 n/a
2 TRCN0000420570 ATGCACAGGACTTAGTCAATT pLKO_005 1405 CDS 100% 13.200 18.480 N FGD6 n/a
3 TRCN0000047272 CGTCAAACAGTGAGCCTTCAA pLKO.1 1993 CDS 100% 4.950 6.930 N FGD6 n/a
4 TRCN0000047270 GCTGGGCCATAGAGAGAATTT pLKO.1 584 CDS 100% 13.200 10.560 N FGD6 n/a
5 TRCN0000418076 TGATGAGACTTTGACTATAAA pLKO_005 668 CDS 100% 15.000 10.500 N FGD6 n/a
6 TRCN0000047268 CCCAAGTTTGTTGTGGCAAAT pLKO.1 273 CDS 100% 10.800 7.560 N FGD6 n/a
7 TRCN0000047271 GCTTAAATGGACACCATGAAA pLKO.1 3454 CDS 100% 5.625 3.938 N FGD6 n/a
8 TRCN0000047269 CGGATTCTAAATCAGATCCTA pLKO.1 2973 CDS 100% 3.000 2.100 N FGD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018351.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12273 pDONR223 100% 26.1% 25.8% None (many diffs) n/a
2 ccsbBroad304_12273 pLX_304 0% 26.1% 25.8% V5 (many diffs) n/a
3 TRCN0000478690 AGCGGCTGCCGCATGCCTAAACTA pLX_317 29% 26.1% 25.8% V5 (many diffs) n/a
Download CSV