Transcript: Human NM_018353.5

Homo sapiens MIS18 binding protein 1 (MIS18BP1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
MIS18BP1 (55320)
Length:
4577
CDS:
260..3658

Additional Resources:

NCBI RefSeq record:
NM_018353.5
NBCI Gene record:
MIS18BP1 (55320)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018353.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017672 CCGTGACATAAGGAAATCAAT pLKO.1 1753 CDS 100% 5.625 7.875 N MIS18BP1 n/a
2 TRCN0000017669 GCGATGAACGTGACTTACTTA pLKO.1 2400 CDS 100% 5.625 7.875 N MIS18BP1 n/a
3 TRCN0000017671 GCTAGGTTCTATAAATAGGAA pLKO.1 3394 CDS 100% 3.000 4.200 N MIS18BP1 n/a
4 TRCN0000017668 CGTCAAAGAAACTCTTCAGAA pLKO.1 2773 CDS 100% 4.950 3.960 N MIS18BP1 n/a
5 TRCN0000017670 GCACAACAAACTTAGGACTAT pLKO.1 1528 CDS 100% 4.950 3.960 N MIS18BP1 n/a
6 TRCN0000433871 TCATTGCTGCAGCTTACTAAA pLKO_005 3816 3UTR 100% 13.200 9.240 N MIS18BP1 n/a
7 TRCN0000435490 TGAGACTCTCAGTACTAATTG pLKO_005 1114 CDS 100% 13.200 9.240 N MIS18BP1 n/a
8 TRCN0000436629 ATCCAAGCCAGAGTAGGATTT pLKO_005 4093 3UTR 100% 10.800 7.560 N MIS18BP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018353.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08516 pDONR223 100% 99.9% 99.8% None 266C>T;2759G>A n/a
2 ccsbBroad304_08516 pLX_304 0% 99.9% 99.8% V5 266C>T;2759G>A n/a
3 TRCN0000479353 TTCGTCTGATTAGCCACAGTGCCA pLX_317 15.7% 99.9% 99.8% V5 266C>T;2759G>A n/a
Download CSV