Transcript: Human NM_018396.2

Homo sapiens methyltransferase like 2B (METTL2B), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
METTL2B (55798)
Length:
2192
CDS:
38..1174

Additional Resources:

NCBI RefSeq record:
NM_018396.2
NBCI Gene record:
METTL2B (55798)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415487 GATGGTACTTCTGCGAGATTA pLKO_005 895 CDS 100% 13.200 9.240 N METTL2B n/a
2 TRCN0000434799 GAAGTATGTGAATGTAGAAAC pLKO_005 401 CDS 100% 10.800 7.560 N METTL2B n/a
3 TRCN0000414979 ACCTTAAACCACCATTTATTT pLKO_005 1592 3UTR 100% 15.000 9.000 N METTL2B n/a
4 TRCN0000034638 CCAAGGGCAGTCTTGATATTA pLKO.1 786 CDS 100% 15.000 7.500 Y METTL2B n/a
5 TRCN0000161764 CCAAGGGCAGTCTTGATATTA pLKO.1 786 CDS 100% 15.000 7.500 Y METTL2A n/a
6 TRCN0000159904 GCTAGGCAATTGCAGTTAATA pLKO.1 1691 3UTR 100% 15.000 7.500 Y METTL2A n/a
7 TRCN0000159690 GTCAGTGTCTATCTGGAAATT pLKO.1 954 CDS 100% 13.200 6.600 Y METTL2A n/a
8 TRCN0000034637 GTCCAGACAAATTCAGAATAT pLKO.1 701 CDS 100% 13.200 6.600 Y METTL2B n/a
9 TRCN0000159689 GTCCAGACAAATTCAGAATAT pLKO.1 701 CDS 100% 13.200 6.600 Y METTL2A n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1894 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1894 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000034635 CCACAAATACTGGAATGACTT pLKO.1 259 CDS 100% 4.950 2.475 Y METTL2B n/a
13 TRCN0000034634 CCTGGTTTAATAATGGAAGAA pLKO.1 434 CDS 100% 4.950 2.475 Y METTL2B n/a
14 TRCN0000034636 CGGGTTTGGATTCAGTGCAAA pLKO.1 1121 CDS 100% 4.950 2.475 Y METTL2B n/a
15 TRCN0000158629 CTCTTTGTTTATTGCTGTGAT pLKO.1 656 CDS 100% 4.950 2.475 Y METTL2A n/a
16 TRCN0000159210 GAGGAGAATGTAACTCAGAAA pLKO.1 509 CDS 100% 4.950 2.475 Y METTL2A n/a
17 TRCN0000163717 GAGGTGATGGAACCAGAGTTT pLKO.1 984 CDS 100% 4.950 2.475 Y METTL2A n/a
18 TRCN0000161051 GACCTGGAAATTTGTGCTGAT pLKO.1 536 CDS 100% 4.050 2.025 Y METTL2A n/a
19 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1892 3UTR 100% 4.950 2.475 Y ERN2 n/a
20 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1892 3UTR 100% 4.950 2.475 Y P3H4 n/a
21 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1892 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018396.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13584 pDONR223 100% 63.3% 63.4% None (many diffs) n/a
2 ccsbBroad304_13584 pLX_304 0% 63.3% 63.4% V5 (many diffs) n/a
3 TRCN0000474535 GGGGACCAAAAATATGAGCCTGAC pLX_317 78.5% 63.3% 63.4% V5 (many diffs) n/a
Download CSV