Transcript: Human NM_018398.3

Homo sapiens calcium voltage-gated channel auxiliary subunit alpha2delta 3 (CACNA2D3), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CACNA2D3 (55799)
Length:
3789
CDS:
163..3438

Additional Resources:

NCBI RefSeq record:
NM_018398.3
NBCI Gene record:
CACNA2D3 (55799)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045167 GCACTCCGATATGACAGCTAA pLKO.1 3015 CDS 100% 4.950 6.930 N CACNA2D3 n/a
2 TRCN0000045166 CGAGGGAATGTAACCATCGAA pLKO.1 2050 CDS 100% 3.000 4.200 N CACNA2D3 n/a
3 TRCN0000045163 CCCATTGAAATCAGGTATAAT pLKO.1 3247 CDS 100% 15.000 10.500 N CACNA2D3 n/a
4 TRCN0000432459 CCTTAAGTGTGAACGTCTAAA pLKO_005 3273 CDS 100% 13.200 9.240 N CACNA2D3 n/a
5 TRCN0000045165 GCACACCTGAAACATGAATTT pLKO.1 508 CDS 100% 13.200 9.240 N CACNA2D3 n/a
6 TRCN0000433822 TGATGACAAATGACTACTATT pLKO_005 1958 CDS 100% 13.200 9.240 N CACNA2D3 n/a
7 TRCN0000069024 GCACCCATTGAAATCAGGTAT pLKO.1 3244 CDS 100% 4.950 3.465 N Cacna2d3 n/a
8 TRCN0000045164 GCCTGTGTTTAGTAAGCAGAA pLKO.1 1605 CDS 100% 4.050 2.835 N CACNA2D3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08590 pDONR223 100% 99.9% 100% None 2265C>T n/a
2 ccsbBroad304_08590 pLX_304 0% 99.9% 100% V5 2265C>T n/a
3 TRCN0000492057 AAGTTTCTGTGCTCACCTTCCAGT pLX_317 10.6% 99.9% 100% V5 2265C>T n/a
Download CSV