Transcript: Human NM_018694.3

Homo sapiens ADP ribosylation factor like GTPase 6 interacting protein 4 (ARL6IP4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
ARL6IP4 (51329)
Length:
1657
CDS:
146..1411

Additional Resources:

NCBI RefSeq record:
NM_018694.3
NBCI Gene record:
ARL6IP4 (51329)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018694.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193887 CACAGAGAGATCAACAAGCAA pLKO.1 1337 CDS 100% 3.000 4.200 N Arl6ip4 n/a
2 TRCN0000144584 GAGGAAATCGTAACCAAAGAA pLKO.1 1313 CDS 100% 5.625 3.938 N ARL6IP4 n/a
3 TRCN0000142241 GAGGTCCTAGAGGAAATCGTA pLKO.1 1304 CDS 100% 3.000 2.100 N ARL6IP4 n/a
4 TRCN0000175698 GTAACCAAAGAACGACACAGA pLKO.1 1322 CDS 100% 2.640 1.848 N Arl6ip4 n/a
5 TRCN0000142650 GAAGTACAAGGACAAGAGGAG pLKO.1 1012 CDS 100% 2.160 1.512 N ARL6IP4 n/a
6 TRCN0000122065 CAAGAGGAGGAAGAAGAAGAA pLKO.1 1024 CDS 100% 4.950 2.970 N ARL6IP4 n/a
7 TRCN0000141779 GACAAGAGGAGGAAGAAGAAG pLKO.1 1022 CDS 100% 4.950 2.970 N ARL6IP4 n/a
8 TRCN0000142125 GAAGAAGAAGGGCAAGGAGAA pLKO.1 1060 CDS 100% 4.050 2.430 N ARL6IP4 n/a
9 TRCN0000143679 GAGAAAGAAGAAGAGCAGGAA pLKO.1 766 CDS 100% 2.640 1.584 N ARL6IP4 n/a
10 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 1036 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
11 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 1027 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
12 TRCN0000145134 GAAGAAGAAGAAGAAGAGGAA pLKO.1 1033 CDS 100% 2.640 1.320 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018694.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11977 pDONR223 100% 51.7% 51.7% None 1_552del;678_734del n/a
2 ccsbBroad304_11977 pLX_304 0% 51.7% 51.7% V5 1_552del;678_734del n/a
3 TRCN0000473687 TTCGCCTTTTCAAAATTCGCCAAT pLX_317 33.9% 51.7% 51.7% V5 1_552del;678_734del n/a
4 ccsbBroadEn_11976 pDONR223 100% 49.2% 46.8% None (many diffs) n/a
5 ccsbBroad304_11976 pLX_304 0% 49.2% 46.8% V5 (many diffs) n/a
Download CSV