Transcript: Human NM_018719.5

Homo sapiens cell division cycle associated 7 like (CDCA7L), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CDCA7L (55536)
Length:
2883
CDS:
96..1460

Additional Resources:

NCBI RefSeq record:
NM_018719.5
NBCI Gene record:
CDCA7L (55536)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018719.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364569 CACTGTCTCAGCCGCTAAATT pLKO_005 953 CDS 100% 15.000 21.000 N CDCA7L n/a
2 TRCN0000364645 CAGACGACGTCACCGTATATC pLKO_005 1034 CDS 100% 13.200 18.480 N CDCA7L n/a
3 TRCN0000364646 GCCATAACTGTTCGAGATAAA pLKO_005 1104 CDS 100% 13.200 18.480 N CDCA7L n/a
4 TRCN0000364647 TAGACCACACACATCGTTTAA pLKO_005 1880 3UTR 100% 13.200 18.480 N CDCA7L n/a
5 TRCN0000369291 GGTCTAGAAGAAGTAGTATTG pLKO_005 496 CDS 100% 10.800 15.120 N CDCA7L n/a
6 TRCN0000017934 GCACGCTTACAGAATGAGAAA pLKO.1 603 CDS 100% 4.950 6.930 N CDCA7L n/a
7 TRCN0000017937 CCAGTTATTGGCGGAATTGAA pLKO.1 782 CDS 100% 5.625 4.500 N CDCA7L n/a
8 TRCN0000364570 GCCATGCTTGCCCAGTTATTG pLKO_005 771 CDS 100% 13.200 9.240 N CDCA7L n/a
9 TRCN0000369366 AGCTCCTGCACTTGATCTATC pLKO_005 1789 3UTR 100% 10.800 7.560 N CDCA7L n/a
10 TRCN0000369292 CTGTAGACAGGTGATACAAAG pLKO_005 650 CDS 100% 10.800 7.560 N CDCA7L n/a
11 TRCN0000017935 GCCACAGGAATCCTCATTCAT pLKO.1 1362 CDS 100% 5.625 3.938 N CDCA7L n/a
12 TRCN0000017933 GCAGGATTTACGCAGAGTGAT pLKO.1 348 CDS 100% 4.950 3.465 N CDCA7L n/a
13 TRCN0000017936 CCCTAAAGAAGTGGCTGACAT pLKO.1 122 CDS 100% 4.950 2.970 N CDCA7L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018719.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12223 pDONR223 100% 99.7% 99.7% None 163_165delCAG n/a
2 ccsbBroad304_12223 pLX_304 0% 99.7% 99.7% V5 163_165delCAG n/a
3 TRCN0000471994 AGCGGCCGATGCGGATAGGTGTTC pLX_317 30.1% 99.7% 99.7% V5 163_165delCAG n/a
Download CSV