Transcript: Mouse NM_018790.3

Mus musculus activity regulated cytoskeletal-associated protein (Arc), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Arc (11838)
Length:
3059
CDS:
199..1389

Additional Resources:

NCBI RefSeq record:
NM_018790.3
NBCI Gene record:
Arc (11838)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108905 GCAGTGATTCATACCAGTGAA pLKO.1 2006 3UTR 100% 4.950 6.930 N Arc n/a
2 TRCN0000108907 GATGGCTATGACTATACCGTT pLKO.1 685 CDS 100% 2.640 3.696 N Arc n/a
3 TRCN0000108909 AGTCAGTTGAGGCTCAGCAAT pLKO.1 758 CDS 100% 4.950 3.465 N Arc n/a
4 TRCN0000108908 CCCAATGTGATCCTGCAGATT pLKO.1 271 CDS 100% 4.950 3.465 N Arc n/a
5 TRCN0000108906 GAGGAGGAGATCATTCAGTAT pLKO.1 1150 CDS 100% 4.950 3.465 N Arc n/a
6 TRCN0000154726 GAACTGGGTGGAGTTCAAGAA pLKO.1 984 CDS 100% 0.495 0.347 N ARC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018790.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07860 pDONR223 100% 85.9% 92.9% None (many diffs) n/a
2 ccsbBroad304_07860 pLX_304 0% 85.9% 92.9% V5 (many diffs) n/a
3 TRCN0000473369 CACTATGTTACCACATTCCCTTTG pLX_317 36.2% 85.9% 92.9% V5 (many diffs) n/a
Download CSV