Transcript: Mouse NM_018819.4

Mus musculus mitochondrial pyruvate carrier 1 (Mpc1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Mpc1 (55951)
Length:
907
CDS:
79..408

Additional Resources:

NCBI RefSeq record:
NM_018819.4
NBCI Gene record:
Mpc1 (55951)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018819.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432222 CTATTGGGATTTGTGTAATAA pLKO_005 691 3UTR 100% 15.000 21.000 N Mpc1 n/a
2 TRCN0000192165 CTTATCAACTACGAGATGAGT pLKO.1 370 CDS 100% 3.000 4.200 N Mpc1 n/a
3 TRCN0000190666 GCATGCCATGTAACAAACGAA pLKO.1 322 CDS 100% 3.000 4.200 N Mpc1 n/a
4 TRCN0000428320 ATCAGTGGGCGGATGACTTTC pLKO_005 229 CDS 100% 10.800 8.640 N Mpc1 n/a
5 TRCN0000005489 AGAGATTATCAGTGGGCGGAT pLKO.1 222 CDS 100% 2.160 1.728 N MPC1 n/a
6 TRCN0000412623 ATCAATGCTAAACCTTATTTG pLKO_005 578 3UTR 100% 13.200 9.240 N Mpc1 n/a
7 TRCN0000428488 CTATAGCAATCTGTAGTAATA pLKO_005 660 3UTR 100% 13.200 9.240 N Mpc1 n/a
8 TRCN0000189592 CAAACGAAGTAGCTCAGCTCA pLKO.1 335 CDS 100% 2.640 1.848 N Mpc1 n/a
9 TRCN0000201918 CCTACAAGGTACAACCTCGAA pLKO.1 287 CDS 100% 2.640 1.848 N Mpc1 n/a
10 TRCN0000428018 CAAGGACTTCCGGGACTATCT pLKO_005 123 CDS 100% 4.950 2.970 N Mpc1 n/a
11 TRCN0000200986 CTGTTGCTATTCTCTGACATT pLKO.1 255 CDS 100% 4.950 2.970 N Mpc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018819.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03358 pDONR223 100% 90.2% 94.4% None (many diffs) n/a
2 ccsbBroad304_03358 pLX_304 0% 90.2% 94.4% V5 (many diffs) n/a
3 TRCN0000472659 TCGAGCATATCACAATCCAGGTTT pLX_317 100% 90.2% 94.4% V5 (many diffs) n/a
Download CSV