Transcript: Mouse NM_018822.3

Mus musculus N-sulfoglucosamine sulfohydrolase (sulfamidase) (Sgsh), mRNA.

Source:
NCBI, updated 2017-06-25
Taxon:
Mus musculus (mouse)
Gene:
Sgsh (27029)
Length:
4324
CDS:
27..1535

Additional Resources:

NCBI RefSeq record:
NM_018822.3
NBCI Gene record:
Sgsh (27029)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_018822.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101842 CCCATCGACCAAGATTTCTAT pLKO.1 1215 CDS 100% 5.625 7.875 N Sgsh n/a
2 TRCN0000287400 CCCATCGACCAAGATTTCTAT pLKO_005 1215 CDS 100% 5.625 7.875 N Sgsh n/a
3 TRCN0000049503 GCGGAACATCACTAGAATTAA pLKO.1 473 CDS 100% 15.000 12.000 N SGSH n/a
4 TRCN0000307455 GCGGAACATCACTAGAATTAA pLKO_005 473 CDS 100% 15.000 12.000 N Sgsh n/a
5 TRCN0000294892 ACAGCTGCACCTTCTACATAC pLKO_005 1600 3UTR 100% 10.800 7.560 N Sgsh n/a
6 TRCN0000101843 CCAGCATCAGAATGGCATGTA pLKO.1 272 CDS 100% 4.950 3.465 N Sgsh n/a
7 TRCN0000101841 CCACAGCCTTATCTTCCGTAA pLKO.1 191 CDS 100% 4.050 2.835 N Sgsh n/a
8 TRCN0000287399 CCACAGCCTTATCTTCCGTAA pLKO_005 191 CDS 100% 4.050 2.835 N Sgsh n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018822.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06943 pDONR223 100% 84.3% 88.6% None (many diffs) n/a
2 ccsbBroad304_06943 pLX_304 0% 84.3% 88.6% V5 (many diffs) n/a
3 TRCN0000466041 TCGGGATGGATTTGAGCCAAAACA pLX_317 23.6% 84.3% 88.6% V5 (many diffs) n/a
Download CSV