Construct: ORF TRCN0000466041
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005834.1_s317c1
- Derived from:
- ccsbBroadEn_06943
- DNA Barcode:
- TCGGGATGGATTTGAGCCAAAACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SGSH (6448)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466041
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | NM_000199.5 | 99.8% | 100% | 729C>A;1245C>T |
| 2 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_934532.2 | 69.6% | (many diffs) | |
| 3 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | NM_001352921.2 | 66.7% | 64.5% | (many diffs) |
| 4 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XM_017024952.1 | 64.6% | 61.9% | (many diffs) |
| 5 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XM_005257583.4 | 64% | 63.7% | (many diffs) |
| 6 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XM_011525126.1 | 63.3% | 61.9% | (many diffs) |
| 7 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | NM_001352922.2 | 63% | 61.4% | (many diffs) |
| 8 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752585.1 | 56.3% | (many diffs) | |
| 9 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | NR_148201.2 | 51.6% | (many diffs) | |
| 10 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752588.1 | 42.8% | (many diffs) | |
| 11 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752589.1 | 40.9% | (many diffs) | |
| 12 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752590.1 | 40.7% | (many diffs) | |
| 13 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752591.1 | 39.4% | (many diffs) | |
| 14 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752592.1 | 27.8% | (many diffs) | |
| 15 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752587.1 | 27.7% | (many diffs) | |
| 16 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_001752586.1 | 27.5% | (many diffs) | |
| 17 | human | 6448 | SGSH | N-sulfoglucosamine sulfohyd... | XR_002958057.1 | 24.7% | (many diffs) | |
| 18 | mouse | 27029 | Sgsh | N-sulfoglucosamine sulfohyd... | NM_018822.3 | 84.3% | 88.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1572
- ORF length:
- 1506
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ctgccccgtg cccgcctgct gcgcgctgct gctagtcctg gggctctgcc 121 gggcgcgtcc ccggaacgca ctgctgctcc tcgcggatga cggaggcttt gagagtggcg 181 cgtacaacaa cagcgccatc gccaccccgc acctggacgc cttggcccgc cgcagcctcc 241 tctttcgcaa tgccttcacc tcggtcagca gctgctctcc cagccgcgcc agcctcctca 301 ctggcctgcc ccagcatcag aatgggatgt acgggctgca ccaggacgtg caccacttca 361 actccttcga caaggtgcgg agcctgccgc tgctgctcag ccaagctggt gtgcgcacag 421 gcatcatcgg gaagaagcac gtggggccgg agaccgtgta cccgtttgac tttgcgtaca 481 cggaggagaa tggctccgtc ctccaggtgg ggcggaacat cactagaatt aagctgctcg 541 tccggaaatt cctgcagact caggatgacc ggcctttctt cctctacgtc gccttccacg 601 acccccaccg ctgtgggcac tcccagcccc agtacggaac cttctgtgag aagtttggca 661 acggagagag cggcatgggt cgtatcccag actggacccc ccaggcctac gacccactgg 721 acgtgctggt gccttacttc gtccccaaca ccccggcagc ccgagccgac ctggccgctc 781 agtacaccac cgtaggccgc atggaccaag gagttggact ggtgctccag gagctgcgtg 841 acgccggtgt cctgaacgac acactggtga tcttcacgtc cgacaacggg atccccttcc 901 ccagcggcag gaccaacctg tactggccgg gcactgctga acccttactg gtgtcatccc 961 cggagcaccc aaaacgctgg ggccaagtca gcgaggccta cgtgagcctc ctagacctca 1021 cgcccaccat cttggattgg ttctcgatcc cgtaccccag ctacgccatc tttggctcga 1081 agaccatcca cctcactggc cggtccctcc tgccggcgct ggaggccgag cccctctggg 1141 ccaccgtctt tggcagccag agccaccacg aggtcaccat gtcctacccc atgcgctccg 1201 tgcagcaccg gcacttccgc cTCGTGCACA ACCTCAACTT CAAGATGCCC TTTCCCATCG 1261 ACCAGGACTT CTACGTCTCA CCCACCTTCC AGGACCTCCT GAACCGCACT ACAGCTGGTC 1321 AGCCCACGGG CTGGTACAAG GACCTCCGTC ATTACTACTA CCGGGCGCGC TGGGAGCTCT 1381 ACGACCGGAG CCGGGACCCC CACGAGACCC AGAACCTGGC CACCGACCCG CGCTTTGCTC 1441 AGCTTCTGGA GATGCTTCGG GACCAGCTGG CCAAGTGGCA GTGGGAGACC CACGACCCCT 1501 GGGTGTGCGC CCCCGACGGC GTCCTGGAGG AGAAGCTCTC TCCCCAGTGC CAGCCCCTCC 1561 ACAATGAGCT GTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1621 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1681 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCG GGATGGATTT GAGCCAAAAC 1741 AACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t