Transcript: Human NM_018900.3

Homo sapiens protocadherin alpha 1 (PCDHA1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
PCDHA1 (56147)
Length:
5415
CDS:
156..3008

Additional Resources:

NCBI RefSeq record:
NM_018900.3
NBCI Gene record:
PCDHA1 (56147)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018900.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053269 CCAAGTCTTAACACGTCAGAA pLKO.1 2487 CDS 100% 4.950 6.930 N PCDHA1 n/a
2 TRCN0000426901 GAACATTAGTGACCACATTAA pLKO_005 928 CDS 100% 13.200 9.240 N PCDHA1 n/a
3 TRCN0000432624 GATGCTGACGAAGGTGTAAAT pLKO_005 957 CDS 100% 13.200 9.240 N PCDHA1 n/a
4 TRCN0000053271 CAGTGGTATTTCTCGTGACAT pLKO.1 1001 CDS 100% 4.950 3.465 N PCDHA1 n/a
5 TRCN0000053268 CCCGAGTGATTATTTCTCTTT pLKO.1 674 CDS 100% 4.950 3.465 N PCDHA1 n/a
6 TRCN0000053270 GCAAGTGATGAACTGAGTAAA pLKO.1 705 CDS 100% 13.200 7.920 N PCDHA1 n/a
7 TRCN0000056018 GCCTGAAACATCTGTATTATA pLKO.1 4052 3UTR 100% 15.000 7.500 Y PCDHA8 n/a
8 TRCN0000094754 GCTGCTACAGAAGTGCTTTAA pLKO.1 4024 3UTR 100% 13.200 6.600 Y Pcdha5 n/a
9 TRCN0000053275 CTGGAGGTAAATCTGCAGAAT pLKO.1 378 CDS 100% 4.950 2.475 Y PCDHA9 n/a
10 TRCN0000094877 ACAAATTCATTATCCCAGGAT pLKO.1 2812 CDS 100% 2.640 1.320 Y Pcdha8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018900.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10461 pDONR223 100% 81.9% 80.8% None (many diffs) n/a
2 ccsbBroad304_10461 pLX_304 0% 81.9% 80.8% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000491834 GGCGCATTCTGATCGATACCCATC pLX_317 13.2% 81.9% 80.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV