Transcript: Human NM_018973.3

Homo sapiens dolichyl-phosphate mannosyltransferase subunit 3, regulatory (DPM3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
DPM3 (54344)
Length:
532
CDS:
78..446

Additional Resources:

NCBI RefSeq record:
NM_018973.3
NBCI Gene record:
DPM3 (54344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018973.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035275 CCATGACGAAATTAGCGCAGT pLKO.1 166 CDS 100% 2.160 3.024 N DPM3 n/a
2 TRCN0000370594 CTAGCGATCCTGGGCTCCACC pLKO_005 198 CDS 100% 0.000 0.000 N DPM3 n/a
3 TRCN0000035277 CGAAATTAGCGCAGTGGCTTT pLKO.1 172 CDS 100% 4.050 3.240 N DPM3 n/a
4 TRCN0000291737 CGAAATTAGCGCAGTGGCTTT pLKO_005 172 CDS 100% 4.050 3.240 N DPM3 n/a
5 TRCN0000303345 TGCTTCCTTCTCTCGCAGTGA pLKO_005 145 CDS 100% 2.640 1.848 N DPM3 n/a
6 TRCN0000370592 TTTCCTTTCTGCTCCTCAGGG pLKO_005 118 CDS 100% 2.160 1.512 N DPM3 n/a
7 TRCN0000303285 TGTCCTGCCAGGAAGTCCTGT pLKO_005 262 CDS 100% 0.880 0.616 N DPM3 n/a
8 TRCN0000370593 TTTCATGACTGCGAGGACGCC pLKO_005 357 CDS 100% 0.180 0.126 N DPM3 n/a
9 TRCN0000370659 CCTGGGCACTGTGGGCTATCG pLKO_005 326 CDS 100% 0.000 0.000 N DPM3 n/a
10 TRCN0000035274 GCAGTGACCATGACGAAATTA pLKO.1 159 CDS 100% 15.000 9.000 N DPM3 n/a
11 TRCN0000291736 GCAGTGACCATGACGAAATTA pLKO_005 159 CDS 100% 15.000 9.000 N DPM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018973.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03410 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03410 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469960 CTGTTTCAGTGGCGGCAATATCAG pLX_317 82.5% 100% 100% V5 n/a
Download CSV