Transcript: Human NM_019051.3

Homo sapiens mitochondrial ribosomal protein L50 (MRPL50), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
MRPL50 (54534)
Length:
3336
CDS:
27..503

Additional Resources:

NCBI RefSeq record:
NM_019051.3
NBCI Gene record:
MRPL50 (54534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019051.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167792 GCATTGCACATACACAAATAA pLKO.1 877 3UTR 100% 15.000 21.000 N MRPL50 n/a
2 TRCN0000240866 CCTATTCAAGATAGATCTAAA pLKO_005 423 CDS 100% 13.200 18.480 N MRPL50 n/a
3 TRCN0000240862 CGTTTGGAATCTTACGTTAAA pLKO_005 231 CDS 100% 13.200 18.480 N MRPL50 n/a
4 TRCN0000167579 GATAGTCGTCTAAAGTTCAAT pLKO.1 303 CDS 100% 5.625 4.500 N MRPL50 n/a
5 TRCN0000167678 GTTCATCTCTTCCTAGTAATT pLKO.1 262 CDS 100% 13.200 9.240 N MRPL50 n/a
6 TRCN0000240863 GTTCATCTCTTCCTAGTAATT pLKO_005 262 CDS 100% 13.200 9.240 N MRPL50 n/a
7 TRCN0000240864 ATCCTAGTGTGTCCACCTTTA pLKO_005 171 CDS 100% 10.800 7.560 N MRPL50 n/a
8 TRCN0000240865 TCATCCTGTTAGGATTCATAT pLKO_005 841 3UTR 100% 13.200 7.920 N MRPL50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019051.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08391 pDONR223 100% 99.5% 99.3% None 379C>T;435C>G n/a
2 ccsbBroad304_08391 pLX_304 0% 99.5% 99.3% V5 379C>T;435C>G n/a
3 TRCN0000478512 ACTTAGCCGCCCATGAGCCCGTTC pLX_317 80.3% 99.5% 99.3% V5 379C>T;435C>G n/a
Download CSV