Transcript: Human NM_019554.3

Homo sapiens S100 calcium binding protein A4 (S100A4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
S100A4 (6275)
Length:
562
CDS:
119..424

Additional Resources:

NCBI RefSeq record:
NM_019554.3
NBCI Gene record:
S100A4 (6275)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019554.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053609 CTTCCAAGAGTACTGTGTCTT pLKO.1 331 CDS 100% 4.950 3.960 N S100A4 n/a
2 TRCN0000053608 GCTCAACAAGTCAGAACTAAA pLKO.1 202 CDS 100% 13.200 9.240 N S100A4 n/a
3 TRCN0000446826 CACAAGTACTCGGGCAAAGAG pLKO_005 167 CDS 100% 4.950 3.465 N S100A4 n/a
4 TRCN0000438093 GTGTCCACCTTCCACAAGTAC pLKO_005 155 CDS 100% 4.950 3.465 N S100A4 n/a
5 TRCN0000416498 TGACAAGTTCAAGCTCAACAA pLKO_005 190 CDS 100% 4.950 3.465 N S100A4 n/a
6 TRCN0000053612 AGCTGCTTTCCAGAAGCTGAT pLKO.1 274 CDS 100% 4.050 2.835 N S100A4 n/a
7 TRCN0000011859 GATGAGCAACTTGGACAGCAA pLKO.1 292 CDS 100% 2.640 1.848 N S100a4 n/a
8 TRCN0000344976 GATGAGCAACTTGGACAGCAA pLKO_005 292 CDS 100% 2.640 1.848 N S100a4 n/a
9 TRCN0000053611 CCCAGATAAGCAGCCCAGGAA pLKO.1 397 CDS 100% 0.880 0.616 N S100A4 n/a
10 TRCN0000053610 CGCCATGATGTGTAACGAATT pLKO.1 364 CDS 100% 0.000 0.000 N S100A4 n/a
11 TRCN0000437516 GAGCAACTTGGACAGCAACAG pLKO_005 295 CDS 100% 4.050 2.430 N S100A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019554.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01474 pDONR223 100% 100% 100% None n/a
2 TRCN0000466183 TGACACACAATCGTTTTGTGCCAA pLX_317 100% 100% 100% V5 n/a
Download CSV