Transcript: Mouse NM_019743.3

Mus musculus RING1 and YY1 binding protein (Rybp), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Rybp (56353)
Length:
4376
CDS:
82..768

Additional Resources:

NCBI RefSeq record:
NM_019743.3
NBCI Gene record:
Rybp (56353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239841 GGGTCTCAGGGAGGGTTAATT pLKO_005 2815 3UTR 100% 15.000 10.500 N Rybp-ps n/a
2 TRCN0000077218 CCACCGAGTTTGTAGTGCTTA pLKO.1 2270 3UTR 100% 4.950 3.465 N Rybp n/a
3 TRCN0000077220 GCGAAACAAACCACACCTCAA pLKO.1 494 CDS 100% 4.050 2.430 N Rybp n/a
4 TRCN0000077222 GCATACAGTCTGCTAACGCTA pLKO.1 461 CDS 100% 2.640 1.584 N Rybp n/a
5 TRCN0000301399 GCATACAGTCTGCTAACGCTA pLKO_005 461 CDS 100% 2.640 1.584 N Rybp n/a
6 TRCN0000007944 GCTACAACAAAGACCAGCGAA pLKO.1 478 CDS 100% 2.640 1.584 N RYBP n/a
7 TRCN0000239842 ACAGCGCCGAAGCCTTTAAAT pLKO_005 182 CDS 100% 15.000 7.500 Y Rybp-ps n/a
8 TRCN0000007943 GCCAAGTATTCGTGTAAATTA pLKO.1 1610 3UTR 100% 15.000 7.500 Y RYBP n/a
9 TRCN0000077219 CCAGGAAACCTCGCATCAATT pLKO.1 236 CDS 100% 13.200 6.600 Y Rybp n/a
10 TRCN0000301400 CCAGGAAACCTCGCATCAATT pLKO_005 236 CDS 100% 13.200 6.600 Y Rybp n/a
11 TRCN0000239843 TGGGCAACGTCACCGTCATTA pLKO_005 569 CDS 100% 13.200 6.600 Y Rybp-ps n/a
12 TRCN0000315343 TGGGCAACGTCACCGTCATTA pLKO_005 569 CDS 100% 13.200 6.600 Y RYBP n/a
13 TRCN0000239844 CAGGAAACCTCGCATCAATTC pLKO_005 237 CDS 100% 10.800 5.400 Y Rybp-ps n/a
14 TRCN0000239840 GCGACATGTCAGCAGTGAATG pLKO_005 734 CDS 100% 10.800 5.400 Y Rybp-ps n/a
15 TRCN0000304267 GATCCTCCTAGTGAAGCTAAC pLKO_005 439 CDS 100% 6.000 3.000 Y Rybp n/a
16 TRCN0000077221 CAGCAGTGAATGATGAATCTT pLKO.1 743 CDS 100% 5.625 2.813 Y Rybp n/a
17 TRCN0000301401 CAGCAGTGAATGATGAATCTT pLKO_005 743 CDS 100% 5.625 2.813 Y Rybp n/a
18 TRCN0000304304 ACCAAAGTCTGATATTCTGAA pLKO_005 417 CDS 100% 4.950 2.475 Y Rybp n/a
19 TRCN0000007945 CACCGTCATTATCACAGACTT pLKO.1 579 CDS 100% 4.950 2.475 Y RYBP n/a
20 TRCN0000140823 GAAGGAGAAGAAGGAGAAGGT pLKO.1 312 CDS 100% 2.640 1.320 Y PTMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019743.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07885 pDONR223 100% 93.5% 98.6% None (many diffs) n/a
2 ccsbBroad304_07885 pLX_304 0% 93.5% 98.6% V5 (many diffs) n/a
3 TRCN0000478796 GCTGCACCCCAATCTCTGACCCTT pLX_317 56.2% 93.5% 98.6% V5 (many diffs) n/a
4 ccsbBroadEn_07884 pDONR223 100% 93.5% 99.1% None (many diffs) n/a
5 ccsbBroad304_07884 pLX_304 0% 93.5% 99.1% V5 (many diffs) n/a
6 TRCN0000471677 TCTGCTGTATCACGGGGTGGGTTT pLX_317 59.6% 93.5% 99.1% V5 (many diffs) n/a
Download CSV