Transcript: Mouse NM_019813.4

Mus musculus drebrin 1 (Dbn1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-13
Taxon:
Mus musculus (mouse)
Gene:
Dbn1 (56320)
Length:
2906
CDS:
129..2111

Additional Resources:

NCBI RefSeq record:
NM_019813.4
NBCI Gene record:
Dbn1 (56320)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019813.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090076 CATTGATCTATGGCCTGGCAA pLKO.1 1574 CDS 100% 2.640 3.696 N Dbn1 n/a
2 TRCN0000090077 GCAGTCTATCTTTGGTGACCA pLKO.1 887 CDS 100% 2.640 3.696 N Dbn1 n/a
3 TRCN0000335208 GCAGTCTATCTTTGGTGACCA pLKO_005 887 CDS 100% 2.640 3.696 N Dbn1 n/a
4 TRCN0000090075 GAGAACCAGAAAGTGATGTAT pLKO.1 303 CDS 100% 5.625 3.938 N Dbn1 n/a
5 TRCN0000335207 GAGAACCAGAAAGTGATGTAT pLKO_005 303 CDS 100% 5.625 3.938 N Dbn1 n/a
6 TRCN0000090074 CCAATGGAGAGACCACTCAAA pLKO.1 1903 CDS 100% 4.950 3.465 N Dbn1 n/a
7 TRCN0000335209 CCAATGGAGAGACCACTCAAA pLKO_005 1903 CDS 100% 4.950 3.465 N Dbn1 n/a
8 TRCN0000090073 CCCAGACCAGATTGTAGCTTA pLKO.1 2383 3UTR 100% 4.950 3.465 N Dbn1 n/a
9 TRCN0000335133 CCCAGACCAGATTGTAGCTTA pLKO_005 2383 3UTR 100% 4.950 3.465 N Dbn1 n/a
10 TRCN0000063960 CAGTCTATCTTTGGTGACCAT pLKO.1 888 CDS 100% 2.640 3.696 N DBN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019813.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06083 pDONR223 100% 84.9% 87.5% None (many diffs) n/a
2 ccsbBroad304_06083 pLX_304 0% 84.9% 87.5% V5 (many diffs) n/a
3 TRCN0000468161 CGATGTTATATATTCCGTACTAAC pLX_317 17.6% 84.9% 87.5% V5 (many diffs) n/a
Download CSV