Transcript: Mouse NM_019827.7

Mus musculus glycogen synthase kinase 3 beta (Gsk3b), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Mus musculus (mouse)
Gene:
Gsk3b (56637)
Length:
8303
CDS:
1526..2788

Additional Resources:

NCBI RefSeq record:
NM_019827.7
NBCI Gene record:
Gsk3b (56637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145264 GTGGCTCCAAAGATCAACTC pXPR_003 TGG 678 54% 6 0.9941 Gsk3b GSK3B 77281
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_019827.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294541 TCCGCTATTGTATACCTTAAA pLKO_005 3110 3UTR 100% 13.200 18.480 N Gsk3b n/a
2 TRCN0000012617 CGGGACCCAAATGTCAAACTA pLKO.1 2555 CDS 100% 5.625 4.500 N Gsk3b n/a
3 TRCN0000294539 CGGGACCCAAATGTCAAACTA pLKO_005 2555 CDS 100% 5.625 4.500 N Gsk3b n/a
4 TRCN0000012615 CATGAAAGTTAGCAGAGATAA pLKO.1 1600 CDS 100% 13.200 9.240 N Gsk3b n/a
5 TRCN0000294540 CATGAAAGTTAGCAGAGATAA pLKO_005 1600 CDS 100% 13.200 9.240 N Gsk3b n/a
6 TRCN0000010551 CACTGGTCACGTTTGGAAAGA pLKO.1 2850 3UTR 100% 4.950 3.465 N GSK3B n/a
7 TRCN0000012614 CCACTCAAGAACTGTCAAGTA pLKO.1 2613 CDS 100% 4.950 3.465 N Gsk3b n/a
8 TRCN0000294607 CCACTCAAGAACTGTCAAGTA pLKO_005 2613 CDS 100% 4.950 3.465 N Gsk3b n/a
9 TRCN0000000822 CCCAAATGTCAAACTACCAAA pLKO.1 2560 CDS 100% 4.950 3.465 N GSK3B n/a
10 TRCN0000012616 CCACAGAACCTCTTGTTGGAT pLKO.1 2075 CDS 100% 3.000 2.100 N Gsk3b n/a
11 TRCN0000294606 CCACAGAACCTCTTGTTGGAT pLKO_005 2075 CDS 100% 3.000 2.100 N Gsk3b n/a
12 TRCN0000079008 CGAGACATTAAACCACAGAAT pLKO.1 2063 CDS 100% 4.950 2.475 Y LOC435230 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019827.7, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488643 CATCTGATGGTGCTTGCACTGTTC pLX_317 28.3% 89.9% 96% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488872 CTACAGCCTCCCTTGCTAACTTCC pLX_317 27.2% 89.9% 95.8% V5 (many diffs) n/a
Download CSV